De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

Verdere optimalisatie van het Ford-project voor het gebruik van Next-generation sequencing in de moleculaire diagnostiek. Bachelorproef - Liselotte Vergote.

Verwante presentaties


Presentatie over: "Verdere optimalisatie van het Ford-project voor het gebruik van Next-generation sequencing in de moleculaire diagnostiek. Bachelorproef - Liselotte Vergote."— Transcript van de presentatie:

1 Verdere optimalisatie van het Ford-project voor het gebruik van Next-generation sequencing in de moleculaire diagnostiek. Bachelorproef - Liselotte Vergote Centrum Medische Genetica Gent Stagementor: Mevrouw Kathleen Claes Promotor: Mevrouw Griet Vanbillemont

2 Inhoudsopgave  Ford-project  CFTR, HFE en MTHFR  Validatie van Ford-assays  Next-generation Sequencing  Resultaten CFTR, HFE en MTHFR  SNP’s in Ford-primers  Besluit

3 Ford-project  Geautomatiseerde workflow  Standaard procedure  Reductie van de prijs  Uitvoerbaar door iedereen

4 Ford-project Werkwijze ‘voor’ Ford  Buffer, dNTP’s, MgCl 2, Taq- polymerase, DNA en primers  primermix  Verschillende PCR-programma’s  Voor mutatiescreening van elk gen is een apart protocol en specifieke detectiemethoden Werkwijze met Ford  Kapa Robust mastermix, DNA en primers  primermix  1 PCR programma  De mutaties in genen kunnen via de Ford-workflow geanalyseerd worden

5 Ford-project PCR uitvoeren met alle gevalideerde Ford-assays voor het te analyseren gen Controle amplificatie via de Labchip Gx poolen van alle PCR amplicons per patiënt Poolen per index Poolen van alle index pools in een sequencing pool Sequeneren met MiSeq Sequencer analyse van de data

6 CFTR, HFE en MTHFR  Nog niet geïntegreerd in de Ford-workflow  Ford-assays moeten ontwikkeld en gevalideerd worden

7 CFTR, HFE en MTHFR  Opgespoorde mutaties in het HFE-gen (hemochromatose):  c.845G>A (assay 1)  c.187C>G (assay 2)  c.193A>T (assay 2)  Opgespoorde mutaties in het MTHFR-gen (trombofilie):  c.677C>T (assay 1)  Opgespoorde mutaties in het CFTR-gen (mucoviscidose):  Top 50 mutatielijst (21 assays)

8 Ford-project  MTHFR assay 1: c.677C>T in exon 4  AAGAACTCAGCGAACTCAGCACTCCACCCAGAGCCCCCAGCCTGTGC GAGGACGGTGCGGTGAGAGTGGGGTGGAGGGAGCTTATGGGCTCTCCT GGGCCCCTCAC CTGGATGGGAAAGATCCCGGGGACGATGGGGCAAGTG ATGCCCATGTCGGTGCATGCCTTCACAAAGCGGAAGAATGTGTCAGCCTCA AAGAAAAGCTGCGTGATGATGAAATCGRCTCCCGCAGACACCTTCTCCTTCA AGTGCTTCAGGTCAGCCTCAAAGCTCCCTGCTTCGGGGTGGCCTTTG GGGTA ACCTGCCAATAGGGATGACAGTCAGGAGAGG

9 Validatie van Ford-assays

10 Detectie van mutaties in het CFTR-gen  Momenteel wordt er gebruik gemaakt van de commerciële kits van INNOLiPA (35 mutaties)

11 Detectie van mutaties in het HFE- en MTHFR-gen  Mutatiescreening via High Resolution Melting Curve Analysis met LightScanner®  Gebruik van fluorescerende kleurstof LC Green

12 Detectie van mutaties in het HFE- en MTHFR-gen  Assymetrische PCR met ongelabelde probes  Probe is complementair aan de streng met de mutatie  Sterkere binding = hogere smelttemperatuur

13 CFTR, HFE en MTHFR  32 DNA controlestalen voor CFTR, 10 DNA controlestalen voor HFE en MTHFR  PCR uitvoeren volgens de Ford-condities en laten sequeneren via Next- generation sequencing met MiSeq

14 Sanger Sequencing

15 Next-generation Sequencing  Library Preparation  Cluster generation  Sequencing by synthesis

16 Next-generation Sequencing

17

18

19

20

21

22

23

24

25 Resultaten CFTR, HFE en MTHFR  Gevonden mutaties via screening in de gewone diagnostiek vergelijken met mutaties gevonden met MiSeq Komen mutaties gevonden in diagnostiek en met MiSeq overeen? CFTR HFE MTHFR

26 Ford-project

27 SNP’s in Ford-primers  Theoretisch geen SNP’s in de laatste 5 nucleotiden AAGAACTCAGCGAACTCAGC  Afspraak in het CMGG: geen SNP’s in de laatste 12 nucleotiden AAGAACTCAGCGAACTCAGC  Primer bevat SNP  risico op allele drop-out  Primers met gedegenereerde base

28 SNP’s in Ford-primers  Ford-condities  nog altijd allele drop-out  Annealingstemperatuur: 60°C  optimale temperatuur bepaald per Ford- assay  Annealingstijd: 10 seconden  35 seconden

29 Ford PCR-programma TijdTemperatuurCycli Activatie3 minuten95°C1 Denaturatie15 seconden95°C 35 Annealing10 seconden60°C Elongatie15 seconden72°C Finaal1 minuut72°C1

30 BRCA en BRCA  SNP c.3119G>A in reverse primer

31 BRCA en BRCA  Mutatie c.3481_3491del homozygoot zichtbaar

32 BRCA en BRCA  Bij optimale annealingstemperatuur 54,3°C

33 BRCA en BRCA  Resultaten bij 54°C

34 BRCA en BRCA  Bij verlengde annealingstijd (35 seconden)

35 Resultaten aangepaste condities Gewone Ford-assay Ford-assay met gedegenereerde base SERPINF1---5SERPINF1---9 Optimale temperatuur (55,3°C en 59,2°C) Heterozygoot Verlengde annealingstijdLicht heterozygoot Heterozygoot BRCA1---17BRCA Optimale temperatuur (54,3°C) Heterozygoot Verlengde annealingstijdLicht heterozygoot BRCA1---20BRCA Optimale temperatuur (57,4°C) Licht heterozygoot Heterozygoot Verlengde annealingstijd HomozygootHeterozygoot

36 SERPINF1---5 en SERPINF1---9

37 BRCA en BRCA1---35

38

39 BRCA en BRCA1---52

40

41 Besluit Validatie CFTR, HFE en MTHFR voor Ford-workflow  Verkregen mutaties CFTR, HFE en MTHFR komen overeen  Installeren softwarefilters + cut-off waarde bepalen

42 Besluit SNP’s in primers  Verlagen annealingstemperatuur  positieve invloed, niet toepasbaar in Ford-workflow  Verlengen annealingstijd + gedegenereerde base  minder risico op allele drop-out  aanpassen in Ford-workflow

43 Verdere optimalisatie van het Ford-project voor het gebruik van Next-generation sequencing in de moleculaire diagnostiek. Bachelorproef - Liselotte Vergote


Download ppt "Verdere optimalisatie van het Ford-project voor het gebruik van Next-generation sequencing in de moleculaire diagnostiek. Bachelorproef - Liselotte Vergote."

Verwante presentaties


Ads door Google