De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

POPULATIE GENETICA WAT IS EEN POPULATIE?. EEN VERZAMELING INDIVIDUEN, DIE EEN BEGRENSD GEBIED BEVOLKEN DE WERELD EEN WERELDDEEL EEN LAND EEN EILAND.

Verwante presentaties


Presentatie over: "POPULATIE GENETICA WAT IS EEN POPULATIE?. EEN VERZAMELING INDIVIDUEN, DIE EEN BEGRENSD GEBIED BEVOLKEN DE WERELD EEN WERELDDEEL EEN LAND EEN EILAND."— Transcript van de presentatie:

1 POPULATIE GENETICA WAT IS EEN POPULATIE?

2 EEN VERZAMELING INDIVIDUEN, DIE EEN BEGRENSD GEBIED BEVOLKEN DE WERELD EEN WERELDDEEL EEN LAND EEN EILAND

3 WAAROM ZIEN INDIVIDUEN IN EEN POPULATIE ER VERSCHILLEND UIT?

4 VARIATIE VAN EEN KENMERK (LENGTE) ERFELIJKE AANLEG -> GENETISCHE VARIATIE GENETICA OMGEVINGSFACTOREN -> OMGEVINGSVARIATIE EPIDEMIOLOGIE GEN-OMGEVINGS INTERACTIE -> GEVOELIGHEID OP BASIS VAN ERFELIJKE AANLEG GENETISCHE EPIDEMIOLOGIE

5 GENETISCHE VARIATIE VERGELIJK DE BASE-VOLGORDE VAN 2 MENSELIJKE GENOMEN: ~ 1/1000 BP IS VERSCHILLEND -> MENSELIJK DNA IS POLYMORF

6 SNP (SINGLE NUCELOTIDE POLYMORPHISM) -----AGGGCTTAGCTAGCTGATCGTAGCTA AGGGCTTAGCTAACTGATCGTAGCTA----- GEWOONLIJK 2 ALLELEN

7 VNTR (VARIABLE NUMBER OF TANDEM REPEATS) -----GTCCGGTACACACACACACACATAACTGATG GTCCGGTACACACACACACATAACTGATG GTCCGGTACACACACACATAACTGATG GTCCGGTACACACACATAACTGATG---- GEWOONLIJK MEER DAN 2 ALLELEN

8 BIJ GENETISCHE VARIATIE WORDT ONDERSCHEID GEMAAKT TUSSEN: FUNCTIONEEL EN NIET-FUNCTIONEEL CA 90% VAN HET DNA HEEFT GEEN FUNCTIE -> 90% VAN DE VARIATIE IS NIET FUNCTIONEEL ~10% VAN DE VARIATIE KAN INVLOED HEBBEN OP GENEXPRESSIE EN IS DAN FUNCTIONEEL

9

10 FUNCTIONELE GENETISCHE VARIATIE C A T T A C G C C A G G T A A T G C G G T C Ile Thr Pro C A T T A T G C C A G G T A A T A C G G T C Ile Met Pro

11 ---ccaat--- // ---tata--- // --catccctccagatag cctat--- // ---tata--- // --catccctccagatag--- ? ? ? FUNCTIONELE GENETISCHE VARIATIE

12 HET TOTAAL VAN ALLE (FUNCTIONELE) ALLELEN IN EEN POPULATIE NOEMEN WE DE GENENPOOL

13 DE WET VAN HARDY WEINBERG BESCHRIJFT DE GENETISCHE STRUCTUUR VAN EEN POPULATIE VOOR WAT BETREFT DE ALLELEN EN GENOTYPEN VOOR EEN GEN MET ALLELEN A EN a MET FREQUENTIES p EN q GELDT: p 2 + 2pq + q 2 = 1 Als verschillende genotypen leiden tot fenotype-verschillen, dan kan uit de kwantitatieve analyse van fenotypen de genotype- en allel-frequenties worden bepaald.

14 Als verschillende genotypen leiden tot fenotype-verschillen, dan kan uit de kwantitatieve analyse van fenotypen de genotype- en allel-frequenties worden bepaald. Voor elk individu, dat nakomelingen genereert is er de kans p dat allel A wordt doorgegeven en de kans q dat a wordt doorgegeven: Individu 1 A (p) a (q) Individu 2 A (p)AA (p 2 ) Aa (pq) a (q) Aa (pq) aa (q 2 )

15 Voorbeeld: albinisme bij Hopi indianen: 26/6000 = 0,0043 Wat is de kans op dragerschap? Autosomaal recessieve aandoening: ** Niet-abino’s zijn homozygoot of heterozygoot voor het normale allel W met frequentie p. ** Albino’s zijn homozygoot voor het abnormale allel w met frequentie q. q= V 0,0043 = 0,065 -> p = 0,935 Dragerschap-frequentie 2pq: 2x0,935x0,065=0,122 (12,2%) (albino gedeelte: ; het deel homozygoot normaal: 0,874)

16 BIJ EEN POPULATIE IN HW EVENWICHT VERANDEREN p EN q NIET OVER DE GENERATIES HEEN INDIEN DE POPULATIE NIET IN EVENWICHT IS, ZIJN ER VERSTORENDE FACTOREN WERKZAAM: DRIFT MUTATIE NON-RANDOM MATING SELECTIE DE POPULATIEGENETICA PROBEERT DEZE INVLOEDEN IN KAART TE BRENGEN OM DAARMEE DE VERANDE- RINGEN TE BEGRIJPEN EN TE VOORSPELLEN.

17 AAAB AA ABAA BAAA ABAA BAAA GENERATIE 1:q = 0.19 GENERATIE 2:q = 0.19 EVENWICHT: ALLELEN HEBBEN 50% KANS PER MEIOSE OM TE WORDEN DOORGEGEVEN

18 AAAB ABAB AA BAAA ABAA BABABA GENERATIE 1:q = 0.19 GENERATIE 2:q = > q = 0.31 DRIFT

19 AAAB AA ABAA BAAA ABAB ABAA BAAA GENERATIE 1:q = 0.19 GENERATIE 2:q = > q = 0.25 MUTATIE: A -> B

20 AAAB AA ABAA BBAA ABAA ABAA BAAA GENERATIE 1:q = 0.19 GENERATIE 2:q = > q = 0.31 NON-RANDOM MATING

21 Indien de waargenomen genotype frequentie afwijkt van de verwachte frequenties volgens de HW-wet, is er geen evenwicht: een of meer van bovengenoemde mechanismen is in de populatie werkzaam

22 Voorbeeld albinisme: 26 albino’s naast 5974 niet-albino’s -> p= 0,935 en q= 0,065 Berekend: Fenotypegenotypefrequentieaantallen Albino’saaq2= 0, DragersAa2pq= 0, OverigenAAp2= 0, In de volgende generatie blijkt het aantal albino’s veel hoger, waaruit kan worden berekend dat het aantal dragers in de ouder-populatie in werkelijkheid 845 bedroeg.

23 Was er in de ouder-populatie sprake van HW-evenwicht? Chi2-test: d 2 /e sommeer (waargenomen-verwacht) 2 /verwacht waargenomenverwachtd 2 /e , ,4 Chi 2 = 17,3 Er is 1 vrijheidsgraad dus p<0.001 Er was geen sprake van evenwicht


Download ppt "POPULATIE GENETICA WAT IS EEN POPULATIE?. EEN VERZAMELING INDIVIDUEN, DIE EEN BEGRENSD GEBIED BEVOLKEN DE WERELD EEN WERELDDEEL EEN LAND EEN EILAND."

Verwante presentaties


Ads door Google