De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

Transcriptie en translatie van het DNA - DNA wordt gedespiraliseerd -De matrijsstreng wordt gekopieerd -RNA Polymerase bindt zich -RNA nucleotiden uit.

Verwante presentaties


Presentatie over: "Transcriptie en translatie van het DNA - DNA wordt gedespiraliseerd -De matrijsstreng wordt gekopieerd -RNA Polymerase bindt zich -RNA nucleotiden uit."— Transcript van de presentatie:

1 Transcriptie en translatie van het DNA - DNA wordt gedespiraliseerd -De matrijsstreng wordt gekopieerd -RNA Polymerase bindt zich -RNA nucleotiden uit het cytoplasma worden aan de DNA streng gekoppeld DNARNA DesoxiriboseSuikerRibose AdenineBasenAdenine Cytosine Guanine ThymineUracil Dubbele strengKetenEnkele streng

2 Verschillende typen RNA m-RNA = messenger RNA – Bevat informatie over de aanmaak van alle noodzakelijke eiwitten t-RNA = transfer RNA – Speelt een rol bij het transport van aminozuren naar de ribosomen r-RNA = ribosomaal RNA – Bevat de informatie voor het maken van de ribosomen

3 Code Start code: stukje DNA gedespiraliseerd Keten verlenging door RNA polymerase Eind code: RNA polymerase koppelt af en kopie is klaar

4

5

6 DNA ATGGTATGAATATATACGAAAACACCCTTAA  Knipenzym X m-RNA-polymerase TACCATACTTATATATGCTTTTGTGGGAATT  Knipenzym Y Benodigdheden:

7 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT DNA bestaat uit een aaneenschakeling van nucleotiden (Nucleotide = desoxyribose + fosfaat + organische base). Alleen de organische basen zijn afgebeeld.  Waterstofbruggen worden verbroken.3 waterstofbruggen tussen Guanine en Cytosine 2 waterstofbruggen tussen Adenine en Thymine

8 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA primair messenger-RNA m-RNA-polymerase schuift over DNA-enkelstreng en maakt primair m-RNA via een polymerisatieproces.

9 ATGGTATGAATATATACGAAAACACCCTTAA AUGGUAUGAAUAUAUACGAAAACACCGUUAA  TACCATACTTATATATGCTTTTGTGGGAATT primair messenger-RNA

10 ATGGTATGAATATATACGAAAACACCCTTAA AUGGUAUGAAUAUAUACGAAAACACCGUUAA TACCATACTTATATATGCTTTTGTGGGAATT

11 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA primair messenger-RNA

12 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA DNA primair messenger-RNA

13 AUGGUAUGAAUAUAUACGAAAACACCGUUAA primair messenger-RNA  Splicing Bepaalde stukken zullen uit dit RNA geknipt worden door bepaalde enzymen. Dit proces heet splicing. Alzo wordt primair messenger-RNA het uiteindelijke messenger- RNA.

14 UGAA primair messenger-RNA AUGGUA Intron ExonExon = Expressed region UAUAUACGAAAACACCGUUAA Exons: delen van het DNA: bevatten DNA dat codeert voor eigenschappen

15 AUGGUACGAAAACACCGUUAA messenger-RNA m-RNA bestaat uit aan elkaar geschakelde nucleotiden (nucleotide = ribose + fosfaat + organische base). De organische basen zijn: U: uracil (i.p.v. thymine bij DNA) A: adenine G: guanine C: cytosine

16

17 AUG GUA CGA AAA CAC CGU UAA m-RNA: Ribosoom: t-RNA RF RF = Release Factor: 30 S 50 S Anti-codon Codon Aminozuur Benodigdheden:

18 AUG GUA CGA AAA CAC CGU UAA AUG = startcodon UAA = stopcodon Valine Arginine Lysine Histidine Arginine Methionine Een codon (triplet) komt overeen met een bepaald aminozuur of duidt start en stop aan. A P

19 AUG GUA CGA AAA CAC CGU UAA AUG = startcodon Het m-RNA zal door het ribosoom schuiven om de codons (3 basen) af te lezen en te vertalen in de overeenstemmende aminozuren. Deze komen voor in het cytoplasma en worden door t-RNA aangeleverd. Deze aminozuren worden aan elkaar gekoppeld tot een eiwit. Met Val Startcodon is AUG: staat voor het aminozuur methionine. Elk eiwit begint dus met het aminozuur methionine.

20 AUG GUA CGA AAA CAC CGU UAA MetVal

21 AUG GUA CGA AAA CAC CGU UAA Val Met

22 AUG GUA CGA AAA CAC CGU UAA Met Val Arg

23 AUG GUA CGA AAA CAC CGU UAA Met Val Arg

24 AUG GUA CGA AAA CAC CGU UAA Met Val Lys Arg

25 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys

26 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His

27 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His

28 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His Arg

29 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His Arg

30 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg

31 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg

32 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg

33 AUG GUA CGA AAA CAC CGU UAA RF EIWIT t-RNA-moleculen worden weer voorzien van hun juiste aminozuren Met ValArg Lys His Arg

34 EIWIT Methionine Valine Arginine Lysine Histidine Arginine Methionine kan afgeknipt worden.

35 m-RNA codons  Aminozuur UAA  Stop CGU  Arginine CAC  Histidine AAA  Lysine CGA  Arginine GUA  Valine AUG  Methionine / Start EIWIT Aan elkaar geschakelde aminozuren Valine Lysine Arginine Histidine Arginine


Download ppt "Transcriptie en translatie van het DNA - DNA wordt gedespiraliseerd -De matrijsstreng wordt gekopieerd -RNA Polymerase bindt zich -RNA nucleotiden uit."

Verwante presentaties


Ads door Google