De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

1. De cel: bouwsteen van het leven LEVER OOG HUID HERSENEN DARM BLOED 2.

Verwante presentaties


Presentatie over: "1. De cel: bouwsteen van het leven LEVER OOG HUID HERSENEN DARM BLOED 2."— Transcript van de presentatie:

1 1

2 De cel: bouwsteen van het leven LEVER OOG HUID HERSENEN DARM BLOED 2

3 Hetzelfde DNA in elke cel 3

4 DE CEL Celkern met DNA RNA Eiwitfabriekjes (ribosomen) 4

5 5

6 DNA-molecule (chromatinedraad) Cel Kern Gen Chromosomen DNA 6

7 Organische stiksof basen Gen A T C G De bouwstenen van DNA Coderende streng Complementaire streng 7

8 Genetische code = code die aminozuren volgorde in eiwit bepaald de code bestaat uit 4 variaties (stikstofbasen): A/T/G/C hiermee moeten 20 aminozuren gecodeerd worden dit is mogelijk door de genetische code per 3 letters af te lezen en daaraan een aminozuur koppelen ATTTGAGCTATCGTAAGG (= opeenvolging in coderende streng) ATT TGA AGC CTA TCG TAA AGG = codogen 8

9 Gen De bouwstenen van DNA Coderende streng Afleesvolgorde: … GCGGCTGTCGGAAAGT… Afleescode: …GCG GCT GTC GGA AAG T… 9

10 20 soorten AMINOZUREN 10

11 Voorstelling van een eiwit 11

12 Belang van eiwitten in een cel Functies van eiwitten: - enzymen - structuureiwitten - hormonen 12

13 DNA ===> m-RNA ===> EIWIT TRANSCRIPTIE TRANSLATIE speelt zich af in de kern speelt zich af in het cytosol (ribosomen) 13

14 Kern DNA basen mRNA DNA eiwit Ribosoom Celmembraan Gen Aminozuur- keten (= eiwit) DNA  m-RNA  eiwit Coderende streng 14

15 TRANSCRIPTIE Hoe wordt de DNA-code omgezet naar m-RNA? 15

16 DNA Benodigdheden ATGGTATGAATATATACGAAAACACCCTTAA  Knipenzym X m-RNA-polymerase TACCATACTTATATATGCTTTTGTGGGAATT  Knipenzym Y 16

17 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT DNA bestaat uit een aaneenschakeling van nucleotiden (Nucleotide = desoxyribose + fosfaat + organische base). Alleen de organische basen zijn afgebeeld.  Waterstofbruggen worden verbroken.3 waterstofbruggen tussen Guanine en Cytosine 2 waterstofbruggen tussen Adenine en Thymine 17

18 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT primair messenger-RNA m-RNA-polymerase schuift over DNA-enkelstreng en maakt primair m-RNA via een polymerisatieproces. AUGGUAUGAAUAUAUACGAAAACACCGUUAA 18

19 ATGGTATGAATATATACGAAAACACCCTTAA AUGGUAUGAAUAUAUACGAAAACACCGUUAA  TACCATACTTATATATGCTTTTGTGGGAATT primair messenger-RNA 19

20 ATGGTATGAATATATACGAAAACACCCTTAA AUGGUAUGAAUAUAUACGAAAACACCGUUAA TACCATACTTATATATGCTTTTGTGGGAATT 20

21 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA primair messenger-RNA 21

22 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA DNA primair messenger-RNA 22

23 AUGGUAUGAAUAUAUACGAAAACACCGUUAA primair messenger-RNA  Splicing Bepaalde stukken zullen uit dit RNA geknipt worden door bepaalde enzymen. Dit proces heet splicing. Alzo wordt primair messenger-RNA het uiteindelijke messenger-RNA. 23

24 UGAA primair messenger-RNA AUGGUA Intron ExonExon = Expressed region UAUAUACGAAAACACCGUUAA 24

25 AUGGUACGAAAACACCGUUAA messenger-RNA m-RNA bestaat uit aan elkaar geschakelde nucleotiden (nucleotide = ribose + fosfaat + organische base). De organische basen zijn: U: uracil (i.p.v. thymine bij DNA) A: adenine G: guanine C: cytosine 25

26 TRANSLATIE Hoe wordt m-RNA omgezet naar eiwit? 26

27 AUG GUA CGA AAA CAC CGU UAA m-RNA ribosoom t-RNA Benodigdheden RF RF = Release Factor 30 S 50 S Anti-codon Codon Aminozuur 27

28 AUG GUA CGA AAA CAC CGU UAA AUG = startcodon UAA = stopcodon Valine Arginine Lysine Histidine Arginine Methionine Een codon (triplet) komt overeen met een bepaald aminozuur of duidt start en stop aan. 28

29 AUG GUA CGA AAA CAC CGU UAA AUG = startcodon Het m-RNA zal doorheen het ribosoom schuiven om de codons (3 basen) af te lezen en te vertalen in de overeenstemmende aminozuren, die aangebracht worden door t-RNA. Deze aminozuren worden aan elkaar gekoppeld tot een eiwit. Met Val 29

30 AUG GUA CGA AAA CAC CGU UAA MetVal 30

31 AUG GUA CGA AAA CAC CGU UAA Val Met 31

32 AUG GUA CGA AAA CAC CGU UAA Met Val Arg 32

33 AUG GUA CGA AAA CAC CGU UAA Met Val Arg 33

34 AUG GUA CGA AAA CAC CGU UAA Met Val Lys Arg 34

35 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys 35

36 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His 36

37 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His 37

38 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His Arg 38

39 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His Arg 39

40 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg 40

41 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg 41

42 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg 42

43 AUG GUA CGA AAA CAC CGU UAA RF EIWIT t-RNA-molecylen worden weer voorzien van hun juiste aminozuren Met ValArg Lys His Arg 43

44 EIWIT Methionine Valine Arginine Lysine Histidine Arginine Methionine kan afgeknipt worden. 44

45 m-RNA codons  Aminozuur UAA  Stop CGU  Arginine CAC  Histidine AAA  Lysine CGA  Arginine GUA  Valine AUG  Methionine / Start EIWIT Aan elkaar geschakelde aminozuren Valine Lysine Arginine Histidine Arginine 45

46 Hoe verkrijgt een eiwit haar 3 dimensionale, werkzame structuur? 46


Download ppt "1. De cel: bouwsteen van het leven LEVER OOG HUID HERSENEN DARM BLOED 2."

Verwante presentaties


Ads door Google