De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

11 Genen A Van gen tot kenmerk AUG GUA CGA AAA CAC CGU UAA AUG = startcodon UAA = stopcodon Valine Arginine Lysine Histidine Arginine Methionine Een.

Verwante presentaties


Presentatie over: "11 Genen A Van gen tot kenmerk AUG GUA CGA AAA CAC CGU UAA AUG = startcodon UAA = stopcodon Valine Arginine Lysine Histidine Arginine Methionine Een."— Transcript van de presentatie:

1

2 11 Genen

3 A Van gen tot kenmerk

4 AUG GUA CGA AAA CAC CGU UAA AUG = startcodon UAA = stopcodon Valine Arginine Lysine Histidine Arginine Methionine Een codon (triplet) komt overeen met een bepaald aminozuur of duidt start en stop aan.

5 GEN EIWIT (enzym) KENMERK GENEN EIWITTEN (enzymen) KENMERK

6 VERBAND GEN - ERFELIJK KENMERK

7 Vb.

8 Maar ook: één gen meerdere eiwitten

9 B Genregulatie Elke cel bevat alle genen Meeste zijn inactief ‘standby’ Andere komen tot ‘expressie’

10 B.1 Genregulatie door inductie (prokaryoot) Een ‘inductor’ activeert de genexpressie Geen inductor structuurgenen niet actief

11 inductor aanwezig repressor niet actief transcriptie van de structuurgenen

12 B.2 Genregulatie door repressie (prokaryoot) Een ‘repressor’ stopt de genexpressie de ‘repressor’ is inactief genexpressie

13 de ‘repressor’ is actief geen genexpressie

14 B.3 Genregulatie bij eukaryote cellen de transcriptie wordt gereguleerd door een integratorgen dat zelf onder controle staat van een sensor die gevoelig is voor oa. hormonen

15 B.4 De epigenetische code Dubbele helix onder de duim?? Verborgen erfelijke code laat genen zwijgen De volgorde van de vier bouwstenen van de dubbele helix is niet het enige wat iemands erfelijke eigenschappen bepaalt. Zelfs wat de moeder eet tijdens de zwangerschap kan invloed hebben! DNA-code is de blauwdruk van het leven maar..

16 Allerlei epigenetische ‘labels’ fungeren als een soort volumeknop waarmee de activiteit van de genen kan gereguleerd worden

17  organisatie chromatine euchromatine heterochromatine DNA sterk gecondenseerd Nucleosomen verder uit elkaar Genexpressie mogelijk

18

19  chemische labels aan de histonen Chemische aanhangsels op de histonen kunnen de expressie van genen … onderdrukken bv. methyl (CH 3 ) bevorderen bv. acetyl (COCH 3 )  

20

21  metylmerkers op DNA Metylgroepen hechten zich op een nucleotide C die gevolgd wordt door een nucleotide C ACTACGAGTAGGATTTTCGATTGTCCCA H-C-H HH H Gen gedeactiveerd

22

23  transposons ‘jumping genes’ Klonen zichzelf en sturen kopieën over het ganse genoom. (oa. afkomstig van virussen) kunnen in genen terechtkomen en mutaties veroorzaken of genexpressie onderdrukken of stimuleren DNA beschermt zich hiertegen door methylering

24

25  imprinting Imprinting verandert genen in de geslachts- cellen waardoor die genen inactief worden. Bij maternale imprinting wordt het gen dat van moeder is geërfd inactief gemaakt en komt dat van vader juist tot uitdrukking. Imprinting van het gen van vaders kant (paternale imprinting) zorgt ervoor dat het gen vaders kant inactief wordt en dat van moeder tot uitdrukking komt.

26 hypotetisch vb. van imprinting Links: maternale imprinting voor het gen van huidskleur; het ‘blank-gen’ van de moeder komt niet tot expressie bij de nakomelingen Rechts: paternale imprinting

27 lijger

28 Lijger ♀ : tijger ♂ : leeuw Tot 500 kg!

29 teeuw ♂ tijger x ♀ leeuw

30  RNA-interferentie (RNAi) Genonderdrukking door dubbelstrengs RNA. •De ‘sense’-sequentie van mRNA bindt zich met de ‘antisense’-sequentie (=dsRNA). •Dit dsRNA bindt zich dan aan een eiwitcomplex Dicer (=‘snijmachine’) dat het in kleinere stukken hakt •Één RNA-streng bijft aan een ander eiwitcomplex (RISC) hangen en vormt een val voor nieuw mRNA  geen translatie mogelijk.

31

32

33


Download ppt "11 Genen A Van gen tot kenmerk AUG GUA CGA AAA CAC CGU UAA AUG = startcodon UAA = stopcodon Valine Arginine Lysine Histidine Arginine Methionine Een."

Verwante presentaties


Ads door Google