De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

EIWITSYNTHESE. De cel: bouwsteen van het leven LEVER OOG HUID HERSENEN DARM BLOED.

Verwante presentaties


Presentatie over: "EIWITSYNTHESE. De cel: bouwsteen van het leven LEVER OOG HUID HERSENEN DARM BLOED."— Transcript van de presentatie:

1 EIWITSYNTHESE

2 De cel: bouwsteen van het leven LEVER OOG HUID HERSENEN DARM BLOED

3 Hetzelfde DNA in elke cel

4 De cel membraan kern organellen

5 DNA-molecuul (chromosoom) Cel Kern Gen Chromosomen DNA

6 DNA-molecuul (chromosoom) Chemische basen Gen A T C G De bouwstenen van DNA

7 Kern DNA basen mRNA DNA eiwit Ribosoom Celmembraan Gen Aminozuur- keten (= eiwit) DNA  RNA  eiwit

8

9

10 DNA Benodigdheden ATGGTATGAATATATACGAAAACACCCTTAA  Knipenzym X m-RNA-polymerase TACCATACTTATATATGCTTTTGTGGGAATT  Knipenzym Y

11 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT DNA bestaat uit een aaneenschakeling van nucleotiden (Nucleotide = desoxyribose + fosfaat + organische base). Alleen de organische basen zijn afgebeeld.  Waterstofbruggen worden verbroken.3 waterstofbruggen tussen Guanine en Cytosine 2 waterstofbruggen tussen Adenine en Thymine

12 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT primair messenger-RNA m-RNA-polymerase schuift over DNA-enkelstreng en maakt primair m-RNA via een polymerisatieproces. AUGGUAUGAAUAUAUACGAAAACACCGUUAA

13 ATGGTATGAATATATACGAAAACACCCTTAA AUGGUAUGAAUAUAUACGAAAACACCGUUAA  TACCATACTTATATATGCTTTTGTGGGAATT primair messenger-RNA

14 ATGGTATGAATATATACGAAAACACCCTTAA AUGGUAUGAAUAUAUACGAAAACACCGUUAA TACCATACTTATATATGCTTTTGTGGGAATT

15 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA primair messenger-RNA

16 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA DNA primair messenger-RNA

17 AUGGUAUGAAUAUAUACGAAAACACCGUUAA primair messenger-RNA  Splicing Bepaalde stukken zullen uit dit RNA geknipt worden door bepaalde enzymen. Dit proces heet splicing. Zo wordt primair messenger-RNA het uiteindelijke messenger-RNA.

18 UGAA primair messenger-RNA AUGGUA Intron ExonExon = Expressed region UAUAUACGAAAACACCGUUAA

19 AUGGUACGAAAACACCGUUAA messenger-RNA m-RNA bestaat uit aan elkaar geschakelde nucleotiden (nucleotide = ribose + fosfaat + organische base). De organische basen zijn: U: uracil (i.p.v. thymine bij DNA) A: adenine G: guanine C: cytosine

20

21 AUG GUA CGA AAA CAC CGU UAA m-RNA ribosoom t-RNA Benodigdheden RF RF = Release Factor 30 S 50 S Anti-codon Codon Aminozuur

22 AUG GUA CGA AAA CAC CGU UAA AUG = startcodon UAA = stopcodon Valine Arginine Lysine Histidine Arginine Methionine Een codon (triplet) komt overeen met een bepaald aminozuur of duidt start en stop aan.

23 AUG GUA CGA AAA CAC CGU UAA AUG = startcodon Het m-RNA zal doorheen het ribosoom schuiven om de codons (3 basen) af te lezen en te vertalen in de overeenstemmende aminozuren, die aangebracht worden door t-RNA. Deze aminozuren worden aan elkaar gekoppeld tot een eiwit. Met Val

24 AUG GUA CGA AAA CAC CGU UAA MetVal

25 AUG GUA CGA AAA CAC CGU UAA Val Met

26 AUG GUA CGA AAA CAC CGU UAA Met Val Arg

27 AUG GUA CGA AAA CAC CGU UAA Met Val Arg

28 AUG GUA CGA AAA CAC CGU UAA Met Val Lys Arg

29 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys

30 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His

31 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His

32 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His Arg

33 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His Arg

34 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg

35 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg

36 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg

37 AUG GUA CGA AAA CAC CGU UAA RF EIWIT t-RNA-molecylen worden weer voorzien van hun juiste aminozuren Met ValArg Lys His Arg

38 EIWIT Methionine Valine Arginine Lysine Histidine Arginine Methionine kan afgeknipt worden.

39 m-RNA codons  Aminozuur UAA  Stop CGU  Arginine CAC  Histidine AAA  Lysine CGA  Arginine GUA  Valine AUG  Methionine / Start EIWIT Aan elkaar geschakelde aminozuren Valine Lysine Arginine Histidine Arginine

40 Is het zo makkelijk? Het basisidee werkt zo maar er is meer; 1.http://www.youtube.com/watch?v=WsofH466lqk 2.http://www.youtube.com/watch?v=YjWuVrzvZYA 3.http://www.youtube.com/watch?v=FVuAwBGw_p Q 4. PSTQ


Download ppt "EIWITSYNTHESE. De cel: bouwsteen van het leven LEVER OOG HUID HERSENEN DARM BLOED."

Verwante presentaties


Ads door Google