De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

EIWITSYNTHESE.

Verwante presentaties


Presentatie over: "EIWITSYNTHESE."— Transcript van de presentatie:

1 EIWITSYNTHESE

2 De cel: bouwsteen van het leven
OOG HERSENEN LEVER DARM De cel is de bouwsteen van elk levend wezen. Sommige organismen bestaan slechts uit één cel (vb. bacterie), andere tellen er zeer veel. De mens bestaat naar schatting uit zo’n tienduizend miljard cellen. Ze liggen aan de basis van alles wat we doen. Onze cellen zijn georganiseerd in weefsels en organen waarin elke cel een specifieke functie uitoefent. Cellen in je maag helpen bij de vertering, cellen in je hart zorgen voor de bloedcirculatie, en dankzij de cellen in je spierweefsel kan je bewegen. De weefsels voorgesteld op de dia zijn: staafjes uit het netvlies van het oog, hersencellen (neuronen) uit de cerebrale cortex, levercellen (hepatocyten) (links is er eentje aan het delen), het darmepitheel met microvilli om voedingsstoffen te absorberen uit de darm, cellen van de huid en bloedcellen (rode, witte (geel) en bloedplaatjes (paars)). HUID BLOED

3 Hetzelfde DNA in elke cel
Het complexe menselijke lichaam, opgebouwd uit miljarden cellen, is gegroeid uit één enkele cel. Die ene cel is ontstaan door een versmelting van een eicel en een zaadcel. Dit eerste celletje deelt zich tot twee dochtercellen die zich op hun beurt opnieuw in twee cellen splitsen. Dit proces blijft zo doorgaan, waarbij alle vitale onderdelen van het menselijke lichaam geleidelijk aan vorm krijgen. Voor elke celdeling wordt een identieke kopij van het DNA gemaakt zodat elke dochtercel hetzelfde DNA bevat als de moedercel. Dankzij dit proces bezit elke cel in ons lichaam hetzelfde DNA: uiteindelijk bevat elke cel een volledige DNA-kopij van de cel waaruit deze is ontstaan en is identiek aan die allereerste bevruchte eicel.

4 De cel membraan kern organellen
Cellen bestaan in talloze variaties, in verschillende groottes en in verschillende vormen. Als we echter naar de binnenkant van cellen kijken, zien we een fundamentele verwantschap. De gemiddelde cel heeft een diameter van ongeveer vijftien micrometer (vijftien miljoenste meter). Dat is ongeveer 200 keer kleiner dan een peperbolletje. Een cel bestaat voor zeventig procent uit water, voor twintig procent uit eiwitten en voor tien procent uit andere biomoleculen en zouten. De cel wordt omsloten door een membraan. Het gelachtig materiaal binnenin de cel heet het cytoplasma. Het is opgebouwd uit een groot aantal organellen, verschillende kleine fabriekjes die specifieke producten (vooral eiwitten) aanmaken. Deze producten worden elders in de cel of in het lichaam gebruikt. Middenin de cel bevindt zich de celkern. De celkern dicteert hoe de cel zich moet gedragen. Hij bevat het DNA, de basis van de erfelijkheid.

5 DNA Cel Kern Chromosomen Gen DNA-molecuul (chromosoom)

6 De bouwstenen van DNA Gen Chemische basen DNA-molecuul (chromosoom) A
Ons erfelijke materiaal is in de celkern opgeslagen. Het bestaat uit een lange streng DNA, die onder een compacte vorm is opgerold. Het DNA bestaat uit slechts vier verschillende bouwstenen of nucleotiden: adenosine, cytidine, guanosine en thymidine. Een nucleotide bestaat uit een base (adenine (A), guanine (G), cytosine (C) en thymine (T)), een suiker en een fosfaatgroep. De nucleotiden volgen elkaar op in één lange keten. De lange DNA-keten, die in elke cel van het menselijke lichaam voorkomt, kan je vergelijken met een dik boek. De volgorde van de nucleotiden kan je lezen als de letters van het boek. De specifieke opeenvolging van letters vormen dan de zinnen, onze genen. De genen geven de cel instructies. Ze geven de opdracht voor de aanmaak van eiwitten. Soms zijn het korte zinnen: genen opgebouwd uit amper enkele honderden letters of nucleotiden. Andere genen zijn net heel lang en bestaan uit enkele miljoenen nucleotiden. C G

7 DNA  RNA  eiwit Celmembraan DNA Kern Aminozuur-keten (= eiwit)
DNA basen mRNA Gen eiwit Het bouwen van eiwitten ligt aan de basis van de celfunctie. Eiwitten zijn de vertaling van wat in onze genen staat. Ze zorgen ervoor dat het lichaam goed functioneert (de vertering van je eten gebeurt door eiwitten die enzymen heten, de afbraak van alcohol in je lever gebeurt ook door enzymen, ...) en bepalen voor een groot stuk je uiterlijk (je haar is eiwit, de kleur van je ogen wordt gemaakt door eiwitten, ...) Om een eiwit te maken wordt de informatie van het gen eerst overgeschreven op een tijdelijke drager: het messenger RNA (mRNA). Dit boodschapper-RNA gaat vervolgens uit de kern naar het cytoplasma waar het door ribosomen vertaald wordt in een keten van aminozuren: een eiwit. Ribosoom

8 Eiwitsynthese DNA >>>>>>> m-RNA>>>>>>> eiwit Transcriptie speelt zich af in de kern Translatie speelt zich af in het cytoplasma

9

10  Knipenzym X  Knipenzym Y TACCATACTTATATATGCTTTTGTGGGAATT
Benodigdheden DNA TACCATACTTATATATGCTTTTGTGGGAATT ATGGTATGAATATATACGAAAACACCCTTAA m-RNA-polymerase  Knipenzym X  Knipenzym Y

11 Waterstofbruggen worden verbroken.
DNA bestaat uit een aaneenschakeling van nucleotiden (Nucleotide = desoxyribose + fosfaat + organische base). Alleen de organische basen zijn afgebeeld. Waterstofbruggen worden verbroken. TACCATACTTATATATGCTTTTGTGGGAATT 3 waterstofbruggen tussen Guanine en Cytosine 2 waterstofbruggen tussen Adenine en Thymine ATGGTATGAATATATACGAAAACACCCTTAA

12 primair messenger-RNA
m-RNA-polymerase schuift over DNA-enkelstreng en maakt primair m-RNA via een polymerisatieproces. TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA primair messenger-RNA ATGGTATGAATATATACGAAAACACCCTTAA

13 primair messenger-RNA
TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA primair messenger-RNA ATGGTATGAATATATACGAAAACACCCTTAA

14 TACCATACTTATATATGCTTTTGTGGGAATT
AUGGUAUGAAUAUAUACGAAAACACCGUUAA ATGGTATGAATATATACGAAAACACCCTTAA

15 primair messenger-RNA
TACCATACTTATATATGCTTTTGTGGGAATT ATGGTATGAATATATACGAAAACACCCTTAA primair messenger-RNA AUGGUAUGAAUAUAUACGAAAACACCGUUAA

16 primair messenger-RNA
DNA TACCATACTTATATATGCTTTTGTGGGAATT ATGGTATGAATATATACGAAAACACCCTTAA primair messenger-RNA AUGGUAUGAAUAUAUACGAAAACACCGUUAA

17 primair messenger-RNA
Bepaalde stukken zullen uit dit RNA geknipt worden door bepaalde enzymen. Dit proces heet splicing. Zo wordt primair messenger-RNA het uiteindelijke messenger-RNA. AUGGUAUGAAUAUAUACGAAAACACCGUUAA Splicing

18 primair messenger-RNA
Exon Exon = Expressed region AUGGUA UAUAUACGAAAACACCGUUAA UGAA Intron

19 AUGGUACGAAAACACCGUUAA
messenger-RNA m-RNA bestaat uit aan elkaar geschakelde nucleotiden (nucleotide = ribose + fosfaat + organische base). AUGGUACGAAAACACCGUUAA De organische basen zijn: U: uracil (i.p.v. thymine bij DNA) A: adenine G: guanine C: cytosine

20 Translatie: vertaling van m-RNA tot eiwit.
Hoe worden eiwitten gemaakt?

21 AUG GUA CGA AAA CAC CGU UAA
Benodigdheden m-RNA Codon Codon Codon Codon Codon Codon Codon AUG GUA CGA AAA CAC CGU UAA RF RF = Release Factor Anti-codon t-RNA UAC CAU GCU ribosoom Aminozuur 30 S UUU GUG GCA 50 S

22 AUG GUA CGA AAA CAC CGU UAA
Een codon (triplet) komt overeen met een bepaald aminozuur of duidt start en stop aan. AUG GUA CGA AAA CAC CGU UAA UAA = stopcodon Arginine Histidine Lysine Arginine Valine Methionine AUG = startcodon

23 AUG GUA CGA AAA CAC CGU UAA
AUG = startcodon AUG GUA CGA AAA CAC CGU UAA UAC Met CAU Val Het m-RNA zal doorheen het ribosoom schuiven om de codons (3 basen) af te lezen en te vertalen in de overeenstemmende aminozuren, die aangebracht worden door t-RNA. Deze aminozuren worden aan elkaar gekoppeld tot een eiwit.

24 AUG GUA CGA AAA CAC CGU UAA
CAU Val Met

25 AUG GUA CGA AAA CAC CGU UAA
CAU UAC Val Met

26 AUG GUA CGA AAA CAC CGU UAA
CAU GCU Arg UAC Val Met

27 AUG GUA CGA AAA CAC CGU UAA
CAU GCU UAC Arg Val Met

28 AUG GUA CGA AAA CAC CGU UAA
GCU UUU Lys CAU UAC Arg Val Met

29 AUG GUA CGA AAA CAC CGU UAA
GCU UUU CAU UAC Lys Arg Val Met

30 AUG GUA CGA AAA CAC CGU UAA
UUU GUG His GCU CAU UAC Lys Arg Val Met

31 AUG GUA CGA AAA CAC CGU UAA
UUU GUG GCU CAU UAC His Lys Arg Val Met

32 AUG GUA CGA AAA CAC CGU UAA
GUG GCA Arg UUU GCU CAU His UAC Lys Arg Val Met

33 AUG GUA CGA AAA CAC CGU UAA
GUG GCA UUU GCU CAU Arg UAC His Lys Arg Val Met

34 AUG GUA CGA AAA CAC CGU UAA
RF GCA GUG UUU GCU Arg CAU His UAC Lys Arg Val Met

35 AUG GUA CGA AAA CAC CGU UAA
RF GCA GUG UUU GCU CAU Arg UAC His Lys Arg Val Met

36 AUG GUA CGA AAA CAC CGU UAA
GCA GUG UUU GCU RF CAU Arg UAC His Lys Arg Val Met

37 AUG GUA CGA AAA CAC CGU UAA
CAU GCU RF t-RNA-molecylen worden weer voorzien van hun juiste aminozuren UUU GUG GCA EIWIT Arg His Lys Val Arg Met

38 EIWIT Arginine Histidine Methionine kan afgeknipt worden. Lysine
Valine Arginine Methionine

39 Aan elkaar geschakelde aminozuren
EIWIT Aan elkaar geschakelde aminozuren Arginine m-RNA codons  Aminozuur UAA  Stop CGU  Arginine CAC  Histidine AAA  Lysine CGA  Arginine GUA  Valine AUG  Methionine / Start Histidine Lysine Valine Arginine

40 Is het zo makkelijk? Het basisidee werkt zo maar er is meer;
1.http://www.youtube.com/watch?v=WsofH466lqk 2.http://www.youtube.com/watch?v=YjWuVrzvZYA 3.http://www.youtube.com/watch?v=FVuAwBGw_pQ 4.


Download ppt "EIWITSYNTHESE."

Verwante presentaties


Ads door Google