De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

Klik hierop Jaak Smeets. Chromosoom Duizenden genen (opslagplaatsen van erfelijke eigenschappen) liggen in de vorm van een lang snoer op het chromosoom.

Verwante presentaties


Presentatie over: "Klik hierop Jaak Smeets. Chromosoom Duizenden genen (opslagplaatsen van erfelijke eigenschappen) liggen in de vorm van een lang snoer op het chromosoom."— Transcript van de presentatie:

1 Klik hierop Jaak Smeets

2

3 Chromosoom Duizenden genen (opslagplaatsen van erfelijke eigenschappen) liggen in de vorm van een lang snoer op het chromosoom. Het chromosoom is een opgevouwen draadvormige structuur van kernzuren (DNA) en eiwitten. In de kunstmatig gekleurde chromosomen van de speekselklieren van een fruitvlieg, Drosophila, zijn donkere banden zichtbaar.

4 In de kern bevinden zich DNA-moleculen die de genetische codes bevatten voor de erfelijke kenmerken. Bij de mens vinden we er 46 DNA-moleculen per cel. KERN DNA CYTOPLASMA

5 DNA CYTOPLASMAKERN In de kern bevinden zich DNA-moleculen, waarvan er hier één is afgebeeld. Het is een dubbelstreng (helix). De DNA-helix ontplooit zich op de plaats waar de genetische codes liggen voor de aanmaak van een bepaald eiwit. Messenger-RNA (boodschapper-RNZ voor een bepaald eiwit) wordt gemaakt, overeenkomstig met de DNA-codes. m-RNA

6 DNA CYTOPLASMAKERN m-RNA wordt losgekopppeld van DNA en de DNA-helix sluit zich weer. m-RNA

7 m-RNA verlaat de celkern via de kernporiën.

8 m-RNA schuift in ribosomen binnen. Ruw endoplasmatisch reticulum Ribosoom m-RNA KERN

9 De eiwitten kunnen terecht komen in het endoplasmatisch reticulum. Ruw endoplasmatisch reticulum Ribosoom m-RNA Eiwit KERN

10 De eiwitten kunnen de cel verlaten. Ruw endoplasmatisch reticulum Ribosoom m-RNA Eiwit KERN

11

12

13 DNA Benodigdheden ATGGTATGAATATATACGAAAACACCCTTAA  Knipenzym X m-RNA-polymerase TACCATACTTATATATGCTTTTGTGGGAATT  Knipenzym Y

14 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT DNA bestaat uit een aaneenschakeling van nucleotiden (Nucleotide = desoxyribose + fosfaat + organische base). Alleen de organische basen zijn afgebeeld.  Waterstofbruggen worden verbroken.3 waterstofbruggen tussen Guanine en Cytosine 2 waterstofbruggen tussen Adenine en Thymine

15 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT primair messenger-RNA m-RNA-polymerase schuift over DNA-enkelstreng en maakt primair m-RNA via een polymerisatieproces. AUGGUAUGAAUAUAUACGAAAACACCGUUAA

16 ATGGTATGAATATATACGAAAACACCCTTAA AUGGUAUGAAUAUAUACGAAAACACCGUUAA  TACCATACTTATATATGCTTTTGTGGGAATT primair messenger-RNA

17 ATGGTATGAATATATACGAAAACACCCTTAA AUGGUAUGAAUAUAUACGAAAACACCGUUAA TACCATACTTATATATGCTTTTGTGGGAATT

18 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA primair messenger-RNA

19 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA DNA primair messenger-RNA

20 AUGGUAUGAAUAUAUACGAAAACACCGUUAA primair messenger-RNA  Splicing Bepaalde stukken zullen uit dit RNA geknipt worden door bepaalde enzymen. Dit proces heet splicing. Alzo wordt primair messenger-RNA het uiteindelijke messenger-RNA.

21 UGAA primair messenger-RNA AUGGUA Intron ExonExon = Expressed region UAUAUACGAAAACACCGUUAA

22 AUGGUACGAAAACACCGUUAA messenger-RNA m-RNA bestaat uit aan elkaar geschakelde nucleotiden (nucleotide = ribose + fosfaat + organische base). De organische basen zijn: U: uracil (i.p.v. thymine bij DNA) A: adenine G: guanine C: cytosine

23

24 AUG GUA CGA AAA CAC CGU UAA m-RNA ribosoom t-RNA Benodigdheden RF RF = Release Factor 30 S 50 S Anti-codon Codon Aminozuur

25 AUG GUA CGA AAA CAC CGU UAA AUG = startcodon UAA = stopcodon Valine Arginine Lysine Histidine Arginine Methionine Een codon (triplet) komt overeen met een bepaald aminozuur of duidt start en stop aan.

26 AUG GUA CGA AAA CAC CGU UAA AUG = startcodon Het m-RNA zal doorheen het ribosoom schuiven om de codons (3 basen) af te lezen en te vertalen in de overeenstemmende aminozuren, die aangebracht worden door t-RNA. Deze aminozuren worden aan elkaar gekoppeld tot een eiwit. Met Val

27 AUG GUA CGA AAA CAC CGU UAA MetVal

28 AUG GUA CGA AAA CAC CGU UAA Val Met

29 AUG GUA CGA AAA CAC CGU UAA Met Val Arg

30 AUG GUA CGA AAA CAC CGU UAA Met Val Arg

31 AUG GUA CGA AAA CAC CGU UAA Met Val Lys Arg

32 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys

33 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His

34 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His

35 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His Arg

36 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His Arg

37 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg

38 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg

39 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg

40 AUG GUA CGA AAA CAC CGU UAA RF EIWIT t-RNA-molecylen worden weer voorzien van hun juiste aminozuren Met ValArg Lys His Arg

41 EIWIT Methionine Valine Arginine Lysine Histidine Arginine Methionine kan afgeknipt worden.

42 m-RNA codons  Aminozuur UAA  Stop CGU  Arginine CAC  Histidine AAA  Lysine CGA  Arginine GUA  Valine AUG  Methionine / Start EIWIT Aan elkaar geschakelde aminozuren Valine Lysine Arginine Histidine Arginine

43

44 Voorbeelden van eiwitten Keratine (in haar) Insuline (hormoon dat suikerspiegel regelt) Hemoglobine (zorgt voor zuurstofvervoer in bloed) Myoglobine (zorgt voor zuurstofopname in spieren) Actine en myosine (spiereiwitten) Albumine (eiwit in eieren, kippeneiwit) Collageen (zorgt voor stevigheid van cellen) Groeihormoon (hormoon dat de groei stimuleert) Chlorofyl (belangrijk bij fotosynthese) Antilichamen (verdediging van het lichaam) Spijsverteringsenzymen zoals: » amylase (voor vertering van zetmeel) » pepsine (voor vertering van eiwitten) » lipase (voor vertering van vetten)

45

46 I le Val GluGln Cys ThrSer I le Ser Leu Tyr GlnLeu Glu Asn -S-S- Cys Tyr Cys Asn Val Gln His Leu Cys Gly Ser His Phe Asn Leu Val Glu Ala Leu TyrLeuVal Sys Gly -S-S- Glu Arg Gly Phe Tyr Thr Pro Lys Ala Insuline bestaat uit een aaneenschakeling van 51 aminozuren. (A-keten: 21 AZ) (B-keten: 30 AZ)

47 Driedimensionele structuur van insuline. Rood = A-keten Blauw = B-keten. Gele bollen = disulfide- binding (-S-S-)

48 De aanmaak van proinsuline door een bacterie (E. coli). Nadien kan men proinsuline omzetten tot insuline. Pancreas (alvleesklier) m-RNA voor proinsuline Recombinant DNA-molecule met genen voor proinsuline inbouw in plasmide DNA voor proinsuline reverse transcriptase BACTERIE

49

50 Injectie van de genen voor groeihormonen in een bevruchte muizeneicel, micropipet met DNA-gen voor groeihormoon Kern van muizeneicel Pipet (zuigt eitje aan en houdt het zo op zijn plaats) doet een reuzenmuis (links) ontstaan die twee maal zwaarder is dan een gewone muis (rechts).

51 Als een cel een eiwit aanmaakt dan zal de genetische code van het DNA bepalen welk eiwit aangemaakt wordt. Eerst worden de DNA-codes overgeschreven op messenger-RNA (bode-RNZ). Daarna zal dit m-RNA met behulp van ribosomen en t-RNA (transport-RNZ) het juiste eiwit maken. Eiwitten kunnen fungeren als hormonen en enzymen. Vele hebben ook een functie in de opbouw (structuur) van cellen. BESLUIT

52 Einde 2 uurscursus Klik hierboven om te eindigen.

53 Terug naar begin

54

55 Chromosoom Duizenden genen (opslagplaatsen van erfelijke eigenschappen) liggen in de vorm van een lang snoer op het chromosoom. Het chromosoom is een opgevouwen draadvormige structuur van kernzuren (DNA) en eiwitten. In de kunstmatig gekleurde chromosomen van de speekselklieren van een fruitvlieg, Drosophila, zijn donkere banden zichtbaar.

56 KERN DNA CYTOPLASMA In de kern bevinden zich DNA-moleculen die de genetische codes bevatten voor de erfelijke kenmerken. Bij de mens vinden we er 46 DNA-moleculen per cel.

57 DNA CYTOPLASMAKERN In de kern bevinden zich DNA-moleculen, waarvan er hier één is afgebeeld. Het is een dubbelstreng (helix). De DNA-helix ontplooit zich op de plaats waar de genetische codes liggen voor de aanmaak van een bepaald eiwit. Messenger-RNA (boodschapper-RNZ voor een bepaald eiwit) wordt gemaakt, overeenkomstig met de DNA-codes. m-RNA

58 DNA CYTOPLASMAKERN m-RNA wordt losgekopppeld van DNA en de DNA-helix sluit zich weer. m-RNA

59 m-RNA verlaat de celkern via de kernporiën.

60

61 m-RNA schuift in ribosomen binnen. Ruw endoplasmatisch reticulum Ribosoom m-RNA KERN

62 De eiwitten kunnen terecht komen in het endoplasmatisch reticulum. Ruw endoplasmatisch reticulum Ribosoom m-RNA Eiwit KERN

63 De eiwitten kunnen de cel verlaten. Ruw endoplasmatisch reticulum Ribosoom m-RNA Eiwit KERN

64

65

66 Voorbeelden van eiwitten Keratine (in haar) Insuline (hormoon dat suikerspiegel regelt) Hemoglobine (zorgt voor zuurstofvervoer in bloed) Myoglobine (zorgt voor zuurstofopname in spieren) Actine en myosine (spiereiwitten) Albumine (eiwit in eieren, kippeneiwit) Collageen (zorgt voor stevigheid van cellen) Groeihormoon (hormoon dat de groei stimuleert) Chlorofyl (belangrijk bij fotosynthese) Antilichamen (verdediging van het lichaam) Spijsverteringsenzymen zoals: » amylase (voor vertering van zetmeel) » pepsine (voor vertering van eiwitten) » lipase (voor vertering van vetten)

67

68 I le Val GluGln Cys ThrSer I le Ser Leu Tyr GlnLeu Glu Asn -S-S- Cys Tyr Cys Asn Val Gln His Leu Cys Gly Ser His Phe Asn Leu Val Glu Ala Leu TyrLeuVal Sys Gly -S-S- Glu Arg Gly Phe Tyr Thr Pro Lys Ala Insuline bestaat uit een aaneenschakeling van 51 aminozuren. (A-keten: 21 AZ) (B-keten: 30 AZ)

69 Driedimensionele structuur van insuline. Rood = A-keten Blauw = B-keten. Gele bollen = disulfide- binding (-S-S-)

70 De aanmaak van insuline door een bacterie (E. coli). Pancreas (alvleesklier) DNA voor insuline BACTERIE Insuline

71

72 Injectie van de genen voor groeihormonen in een bevruchte muizeneicel, micropipet met DNA-gen voor groeihormoon Kern van muizeneicel Pipet (zuigt eitje aan en houdt het zo op zijn plaats) doet een reuzenmuis (links) ontstaan die twee maal zwaarder is dan een gewone muis (rechts).

73 Als een cel een eiwit aanmaakt dan zal de genetische code van het DNA bepalen welk eiwit aangemaakt wordt. Eerst worden de DNA-codes overgeschreven op messenger-RNA (bode-RNZ). Daarna zal dit m-RNA met behulp van ribosomen het juiste eiwit maken. Eiwitten kunnen fungeren als hormonen en enzymen. Vele hebben ook een functie in de opbouw (structuur) van cellen. BESLUIT

74


Download ppt "Klik hierop Jaak Smeets. Chromosoom Duizenden genen (opslagplaatsen van erfelijke eigenschappen) liggen in de vorm van een lang snoer op het chromosoom."

Verwante presentaties


Ads door Google