De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

EIWITSYNTHESE. De cel: bouwsteen van het leven LEVER OOG HUID HERSENEN DARM BLOED.

Verwante presentaties


Presentatie over: "EIWITSYNTHESE. De cel: bouwsteen van het leven LEVER OOG HUID HERSENEN DARM BLOED."— Transcript van de presentatie:

1 EIWITSYNTHESE

2 De cel: bouwsteen van het leven LEVER OOG HUID HERSENEN DARM BLOED

3 Hetzelfde DNA in elke cel

4 De cel membraan kern organellen

5 DNA-molecuul (chromosoom) Cel Kern Gen Chromosomen DNA

6 DNA-molecuul (chromosoom) Chemische basen Gen A T C G De bouwstenen van DNA

7 Kern DNA basen mRNA DNA eiwit Ribosoom Celmembraan Gen Aminozuur- keten (= eiwit) DNA  RNA  eiwit

8

9

10 DNA Benodigdheden ATGGTATGAATATATACGAAAACACCCTTAA  Knipenzym X m-RNA-polymerase TACCATACTTATATATGCTTTTGTGGGAATT  Knipenzym Y

11 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT DNA bestaat uit een aaneenschakeling van nucleotiden (Nucleotide = desoxyribose + fosfaat + organische base). Alleen de organische basen zijn afgebeeld.  Waterstofbruggen worden verbroken.3 waterstofbruggen tussen Guanine en Cytosine 2 waterstofbruggen tussen Adenine en Thymine

12 DNA heeft een richting, dit wordt de 5’- 3’ richting genoemd. De richting van een streng is altijd het tegenovergestelde van de streng die ernaast ligt. TACCATACTTATATATGCTTTTGTGGGAATT 3’ ‘5 ’3 5’ ATGGTATGAATATATACGAAAACACCCTTAA

13 TACCATACTTATATATGCTTTTGTGGGAATT primair messenger-RNA m-RNA-polymerase schuift over DNA-enkelstreng en maakt primair m-RNA via een polymerisatieproces. AUGGUAUGAAUAUAUACGAAAACACCGUUAA 3’ ’35’ ’5

14 ATGGTATGAATATATACGAAAACACCCTTAA AUGGUAUGAAUAUAUACGAAAACACCGUUAA  TACCATACTTATATATGCTTTTGTGGGAATT primair messenger-RNA 5’’3

15 ATGGTATGAATATATACGAAAACACCCTTAA AUGGUAUGAAUAUAUACGAAAACACCGUUAA TACCATACTTATATATGCTTTTGTGGGAATT 5’ ’3

16 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA primair messenger-RNA 5’ ’3

17 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA DNA primair messenger-RNA 5’ ’3

18 AUGGUACGAAAACACCGUUAA messenger-RNA m-RNA bestaat uit aan elkaar geschakelde nucleotiden (nucleotide = ribose + fosfaat + organische base). De organische basen zijn: U: uracil (i.p.v. thymine bij DNA) A: adenine G: guanine C: cytosine 5’ ’3

19

20 AUG GUA CGA AAA CAC CGU UAA m-RNA ribosoom t-RNA Benodigdheden RF RF = Release Factor 30 S 50 S Anti-codon Codon Aminozuur 5’ ’3

21 AUG GUA CGA AAA CAC CGU UAA AUG = startcodon UAA = stopcodon Valine Arginine Lysine Histidine Arginine Methionine Een codon (triplet) komt overeen met een bepaald aminozuur of duidt start en stop aan. Waarom 3 basen per codon??? 5’ ’3

22 Eiwitten zijn opgebouwd uit 20 verschillende aminozuren. Hoeveel basen moet ik combineren om 20 verschillende mogelijkheden te hebben? 1 base? A,U,C of G 4 combinaties 2 basen? AU,UU,CU,GU AA,UA,CA,GA AC,UC,CC,GC AG,UG,CG,GG 16 combinaties

23 3 basen dan? Ja! Want dat levert 4×4×4 (4 3 ) mogelijkheden dus 64 combinaties en dat is zat om voor alle aminozuren te coderen.

24 Eerste base (5’begin) Tweede baseDerde base (3’einde) UCAG UUUU (Phe) fenylalanineUCU (Ser) SerineUAU (Tyr) TyrosineUGU (Cys) CysteïneU UUC (Phe) fenylalanineUCC (Ser) SerineUAC (Tyr) TyrosineUGC (Cys) CysteïneC UUA (Leu) LeucineUCA (Ser) SerineUAA STOPUGA STOPA UUG (Leu) LeucineUCG (Ser) SerineUAG STOPUGG (Trp) Tryptofaan G CCUU (Leu) LeucineCCU (Pro) ProlineCAU (His) HistidineCGU (Arg) ArginineU CUC (Leu) LeucineCCC (Pro) ProlineCAC (His) HistidineCGC (Arg) ArginineC CUA (Leu) LeucineCCA (Pro) ProlineCAA (Gln) GlutamineCGA (Arg) ArginineA CUG (Leu) LeucineCCG (Pro) ProlineCAG (Gln) GlutamineCGG (Arg) ArginineG AAUU (Ile) IsoleucineACU (Thr) Threonine AAU (Asn) AsparagineAGU (Ser) SerineU AUC (Ile) IsoleucineACC (Thr) Threonine AAC (Asn) AsparagineAGC (Ser) SerineC AUA (Ile) IsoleucineACA (Thr) Threonine AAA (Lys) LysineAGA (Arg) ArginineA AUG (Met) Methionine START ACG (Thr) Threonine AAG (Lys) LysineAGG (Arg) ArginineG GGUU (Val) ValineGCU (Ala) AlanineGAU (Asp) Asparaginezuur GGU (Gly) GlycineU GUC (Val) ValineGCC (Ala) AlanineGAC (Asp) Asparaginezuur GGC (Gly) GlycineC GUA (Val) ValineGCA (Ala) AlanineGAA (Glu) GlutaminezuurGGA (Gly) GlycineA GUG (Val) ValineGCG (Ala) AlanineGAG (Glu) GlutaminezuurGGG (Gly) GlycineG

25 AUG GUA CGA AAA CAC CGU UAA AUG = startcodon Het m-RNA zal door het ribosoom heen schuiven om de codons (3 basen) af te lezen en te vertalen in de overeenstemmende aminozuren, die aangebracht worden door t-RNA. Deze aminozuren worden aan elkaar gekoppeld tot een eiwit. Met Val

26 AUG GUA CGA AAA CAC CGU UAA MetVal

27 AUG GUA CGA AAA CAC CGU UAA Val Met

28 AUG GUA CGA AAA CAC CGU UAA Met Val Arg

29 AUG GUA CGA AAA CAC CGU UAA Met Val Arg

30 AUG GUA CGA AAA CAC CGU UAA Met Val Lys Arg

31 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys

32 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His

33 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His

34 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His Arg

35 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His Arg

36 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg

37 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg

38 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg

39 AUG GUA CGA AAA CAC CGU UAA RF EIWIT t-RNA-molecylen worden weer voorzien van hun juiste aminozuren Met ValArg Lys His Arg

40 EIWIT Methionine Valine Arginine Lysine Histidine Arginine Methionine kan afgeknipt worden.

41 m-RNA codons  Aminozuur UAA  Stop CGU  Arginine CAC  Histidine AAA  Lysine CGA  Arginine GUA  Valine AUG  Methionine / Start EIWIT Aan elkaar geschakelde aminozuren Valine Lysine Arginine Histidine Arginine

42 EIWIT Bestaat natuurlijk niet uit 5 aminozuren maar veel meer. Eiwitten zijn de belangrijkste stoffen in cellen. Ze bestaan uit een ketting van aminozuren. Het aantal aminozuren en de volgorde bepaalt het soort eiwit. In een mens zitten zo’n verschillende eiwitten. Voorbeelden:

43 Hemoglobine; De zuurstoftransporteur in rode bloedcellen

44 Myosine (Links) en Actine (hieronder) de Bouwstenen van al je spieren!!!


Download ppt "EIWITSYNTHESE. De cel: bouwsteen van het leven LEVER OOG HUID HERSENEN DARM BLOED."

Verwante presentaties


Ads door Google