De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

Van genotype tot fenotype In DNA bepaalde genen die coderen voor eigenschappen Genen coderen voor eiwitten die ervoor zorgen dat eigenschap tot uiting.

Verwante presentaties


Presentatie over: "Van genotype tot fenotype In DNA bepaalde genen die coderen voor eigenschappen Genen coderen voor eiwitten die ervoor zorgen dat eigenschap tot uiting."— Transcript van de presentatie:

1 Van genotype tot fenotype In DNA bepaalde genen die coderen voor eigenschappen Genen coderen voor eiwitten die ervoor zorgen dat eigenschap tot uiting komt

2 Eiwitten Aan elkaar gekoppelde aminozuren In je lichaam 20 verschillende soorten aminozuren Eiwit specifiek door: – Lengte van de aminozuurketen – Volgorde van aminozuren

3 DNA Erfelijke materiaal – Twee nucleotiden ketens – Elke keten bestaat uit vele duizenden aan elkaar gekoppelde nucleotiden – Nucleotide bestaat uit: Fosfaat groep Desoxyribose Stikstofbase: Adenine (A), Thymine (T), Guanine (G) en Cytosine (C) Stikstofbasen vormen vaste paren met elkaar: A met T en G met C

4

5 Opbouw DNA Desoxyribose is een monosacharide (enkelvoudige suiker). Desoxyribose vormt samen met een fosfaatgroep en één base (Adenine, Thymine, Guanine of Cytosine) een nucleotide (vandaar ook de naam DNA: DesoxyriboNucleic Acid). Nucleotide = Desoxyribose + Fosfaatgroep + Base Verschillende volgorden van deze basen coderen voor verschillende eigenschappen.

6

7

8 Genen Een chromosoom bevat heel veel verschillende genen Eén gen bestaat uit honderden nucleotiden 1 gen 1 eigenschap – Volgorde van nucleotiden – Aantal nucleotiden TACCATACTTATATATGCTTTTGTGGGAATT


Download ppt "Van genotype tot fenotype In DNA bepaalde genen die coderen voor eigenschappen Genen coderen voor eiwitten die ervoor zorgen dat eigenschap tot uiting."

Verwante presentaties


Ads door Google