De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

Noonan syndroom: nieuwe ontwikkelingen Ineke van der Burgt Klinische genetica UMC st Radboud Nijmegen.

Verwante presentaties


Presentatie over: "Noonan syndroom: nieuwe ontwikkelingen Ineke van der Burgt Klinische genetica UMC st Radboud Nijmegen."— Transcript van de presentatie:

1 Noonan syndroom: nieuwe ontwikkelingen Ineke van der Burgt Klinische genetica UMC st Radboud Nijmegen

2 NOONAN SYNDROOM Eerst beschreven in 1963 door Jacqueline Noonan Samen voorkomen: *karakteristiek gezicht *hartafwijking *kleine lengte

3 Autosomaal dominant erfelijk Noonan syndroom

4 2001: het 1 ste gen voor NS is PTPN11

5 NoonanCostelloCFC SOS1 CBL NRAS SHOC2 MAP2K1 MAP2K2 HRAS KRAS Genoomlab Nijmegen Genen die kunnen worden getest Bij 70 – 80% van alle personen met Noonan syndroom wordt een mutatie gevonden Leopard BRAF PTPN11 RAF1

6 The Ras-MAPK pathway

7 Schubbert (2007) Nature reviews De RAS-MAPK pathway

8 Het gelaat bij Noonan syndroom Grote verschillen Subtiel, ook afhankelijk van leeftijd Het gelaat kan onopvallend zijn bij PTPN11+

9 Het hart bij Noonan Syndroom Pulmonaal Stenose meest voorkomend ( %) PS meer voorkomend bij PTPN11+ HOCM bij 20-30% HOCM meer bij RAF1

10 Lengte bij Noonan syndroom Normale lengte bij geboorte Volwassen lengte; mannen 161 cm, vrouwen 152 cm (1986) Kleine lengte vaker bij PTPN11+ Normale lengte vaker bij SOS1+

11 Vertraagde ontwikkeling/leerproblemen PTPN11 hot spot mutatie Vaker normaal onderwijs 922A>G (Asn308Asp) Jongmans,2005 Pierpont,2009 SOS1 mutaties Minder vaak speciaal onderw Zenker,2007 Pierpont, 2009 KRAS mutaties Vaker vertraagde ontwikkeling Zenker,2007 RAF1 mutaties8/21 (milde) Mentale retardatie Pandit,2007 Intelligentie NIET met zekerheid te voorspellen a.h.v. gen mutatie Pierpont, 2009

12 Zoeken van nieuwe genen die Noonan syndroom kunnen veroorzaken Nieuwe techniek: Exoom sequencing = NGS

13 Humane genoom bestaat uit ~6 biljoen bouwsteentjes Een mutatie in 1 bouwsteentje kan een erfelijke aandoening geven Twee mensen hebben verschillen in ~3 miljoen bouwsteentjes Hoe kunnen we betrouwbaar alle varianten vinden en interpreteren?

14 NGS = Next generation sequencing in Nijmegen 2010/11: Exome sequencing voor onopgeloste genetische aandoeningen Nikopoulous et al. AJHG 2010 Hoischen et al. Hum Mut 2010 Hoischen et al. Nat Genet 2010 Gilissen et al. AJHG 2010 Vermeer et al. AJHG 2010 Vissers et al. Nat Genet 2010 Becker et al. AJHG 2011 Van der Veerdonk et al. NEJM 2011

15 Nodig: de novo = nieuwe mutaties CCCAGATGCCCTGTTCCAGGAGGACAGCTACAAGAAACACCTGAAGCATCACTGTAACAAGTATGTTATTAGAGGGTGGACCTGGAGAGCTTAATTCCCTTTTTATTCTTTAAAAAATACATGCAGCCGGCCCTTCACGTCTGCAGATGCAGAACTCGCAGATTTGGAGGGTCAACTGAGGGACCTGAGCATCTGCGGATCTTGGTGTCTGAGGGGGGTCCTGGAACCATACTCCCGCGGATATGGAGGGACAGCTCTG TTATTAAGACTTTTAAATGGTATAGTTATTGCCTTTGCACAGCCTTATCATTTTTCTTGAAATGTGGTGTCAAGTTGCAGGAGAGCGTACCTTTAGGTGACTGATTATTTTTTAACATGGTAAGATACACAACACAACGTTTACCATTTTTACCATTTATAAGTGAACAATTCATTGGCATTAATTACACTCACAATGCTGTATACTCACTATCTGTACCTGAAATGTTTCCATCTTCCCAAATATAAACACTGTATCAATTAAACA

16 Exome sequencing van patient plus beide ouders (trio) Excluderen alle gezamenlijke varianten

17 Filters om de goede “ de novo” variant te vinden Filter # Variants Criteria % Reduction High confidence20994 > 3 unique reads supporting the variant 5% Coding12226In Exon region or Splice site42% Private245Not in controls98% de novo12 Not in the parents raw sequence data 95% Validated2 Sanger sequencing confirms variant and non inheritance 84%

18 Volgend gen voor Noonan syndroom ???!!??!!


Download ppt "Noonan syndroom: nieuwe ontwikkelingen Ineke van der Burgt Klinische genetica UMC st Radboud Nijmegen."

Verwante presentaties


Ads door Google