De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital.

Verwante presentaties


Presentatie over: "UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital."— Transcript van de presentatie:

1 UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital

2 Afdeling Medische Genetica Voortgang in de DNA diagnostiek T.G.W. Letteboer, Klinisch Geneticus Afdeling Medische Genetica, UMC U 9 november 2013

3 DNA diagnostiek HHT1, HHT2, HHT-JP, en toen…. Nieuwe technieken voor bekende families zonder mutatie Conclusie

4 23 chromosomen van iedere ouder

5 DNA

6 celkern cel chromosoom dubbele helix DNA-basen DNA, chromosomen en genen

7 HHT1 HHT2 HHT3 HHT4 JP-HHT

8 HHT1 en HHT2 verschillende genen HHT2 - chromosoom 12 - gen: ACVRL1 (ALK1) vaker HAVM HHT1 - chromosoom 9 - gen: ENG vaker PAVM, CAVM

9 HHT-JP en HHT? Weer andere genen HHT-JP - chromosoom 18 - gen: SMAD4 HHT? - chromosoom 5 of 7 of ? - gen: onbekend

10 En de families zonder mutatie?? •10-15% van de families hebben geen mutatie in ENG, ACVRL1 (ALK1) of SMAD4 •Mogelijke verklaringen zijn: • andere genen veroorzaken HHT • onze technieken pikken niet alle mutaties op (in ENG, ACVRL1 en SMAD4)

11 GTTGCTTGTTTATCACCTGT Vooruitgang in technieken GATC per 3 dagen per ochtend per uur 1ste3de2de

12 bron: Science, 17 maart 2006 Op weg naar het individuele genoom 2009: $ : $ : $ (?)

13 Recent een nieuw gen ontdekt: BMP9

14 BMP9 mutatie veroorzaakt HHT beeld •Ontdekt in 3 personen met HHT •Teleangiectasien en bloedneuzen  (AVMs niet goed onderzocht, wrs 1 HAVMs) •Maar:  Ontdekt in 3 van de 197 onderzochte personen

15 Onbekende families worden onderzocht op BMP9 •Mogelijk dat andere landen (Nederland) BMP9 vaker voor komt dan in Canada •Zo veel mogelijk familie’s zonder mutatie onderzoeken op mutaties in BMP9

16 Mutaties in niet-coderend gebied 5'capaggt poly A- signaal AATAAA splice site Promoter 5’ UTRIntron 3’ UTR

17 Zijn onze technieken niet toereikend?? •Mogelijk niet…. •In samenwerking met Hubrecht laboratorium bij aantal families kijken of er met andere techniek mutaties worden gevonden in de bekende genen

18 We zijn hard bezig de families in kaart te brengen, zonder gen afwijking voor de HHT

19 Vragen ??

20 Chromo- soom Dubbele DNA-helix Gen 1 Gen 2 Eigenschap / Functie Eiwit 2 Eiwit 1 Eigenschap / Functie RNA 1 RNA 2 Van gen naar eiwit

21 Mutaties in niet-coderend gebied 5'capaggt poly A- signaal AATAAA splice site Promoter 5’ UTRIntron 3’ UTR


Download ppt "UMC Utrecht consists of the University Hospital Utrecht the Medical Faculty Utrecht the Wilhelmina Children’s Hospital."

Verwante presentaties


Ads door Google