De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

Leuven, 29 oktober 2009 Prof. Filip Volckaert, evolutiebioloog Departement Biologie, K.U.Leuven, De mens als evolutionaire knutselaar.

Verwante presentaties

Presentatie over: "Leuven, 29 oktober 2009 Prof. Filip Volckaert, evolutiebioloog Departement Biologie, K.U.Leuven, De mens als evolutionaire knutselaar."— Transcript van de presentatie:

1 Leuven, 29 oktober 2009 Prof. Filip Volckaert, evolutiebioloog Departement Biologie, K.U.Leuven, De mens als evolutionaire knutselaar

2 Inhoud 1.Wat is een evolutionaire knutselaar? 2.Wat is de motor van evolutie? 3.Resistentie tegen infecties 4.Verstoorde soortvorming 5.Niet duurzaam oogsten 6.Sporen van selectie bij de mens 7.Waarom zou Darwiniaanse invloed meetellen?

3 1. Wat is een evolutionaire knutselaar? Mens is uniek: maakt producten (huisdieren, bruggen en IT) en organiseert zijn gemeenschap (van familie tot wereld)

4 1. Wat is een evolutionaire knutselaar? Mens is uniek: maakt producten (huisdieren, bruggen en IT) en organiseert zijn gemeenschap (van familie tot wereld) Reeds 2/3 van het land dient rechtstreeks om de menselijke bevolking te ondersteunen Is een experiment op wereldschaal met onverwacht positieve (synergie, vergemakkelijken van leven, …) en negatieve (ecologische voetafdruk, vervuiling, oorlog, global change, infecties, …) gevolgen. Sommige gevolgen van de menselijke tussenkomst spelen zich af op het niveau van evolutie, zijn subtiel en hebben soms grote implicaties

5 2. Wat is de motor van evolutie? Vier belangrijke krachten: Mutatie Genetische drift Genmigratie Selectie

6 A. Mutatie Slaat op overerfbare veranderingen in de genetische code; 1 kans op 10.000 - 10 miljoen per base. Voorbeeld: Originele DNA sekwentie: ACTGGGCTAACGCGTTAACG Mutante DNA sekwentie: ACTGGGCGAACGCGTTAACG Werkt over een breed tijdsbestek: is niet zo algemeen maar kan belangrijke wijzigingen veroorzaken. Dit DNA wordt vertaald in aminozuren (eiwitten). Sommige veranderingen doen niets, andere veroorzaken grote verschillen. Voorbeelden: - oogkleur - erfelijke ziekte mucoviscidose - vatbaarheid van de mens voor lactose tolerantie na de leeftijd van 5 jaar.

7 B. Genetische drift Kleine populaties lopen een grote kans dat algemene variaties (allelen) nog algemener worden en zeldzame allelen uitsterven. Toeval treft vooral kleine groepen. Voorbeeld: Menselijke populaties op eilanden vertonen een grotere kans op inteelt en dus op erfelijke aandoeningen.

8 C. Genmigratie Genmigratie slaat op de verplaatsing van erfelijk materiaal tussen populaties. Is een dagdagelijks gegeven want individuen verplaatsen zich vaak tussen populaties; soms is die verplaatsing permanent. Voorbeelden: - uitzwermen van adolescente vogels (koolmees, sneeuwgans) - nieuwe bruid in het dorp

9 D. Selectie Het leven is hard… Velen zijn geroepen, maar weinigen uitverkoren. Omvat Darwin’s idee van Survival of the fittest. (van de vele nakomelingen, zullen weinigen geslachtsrijp worden) Selectie is dagdagelijkse kost. Voorbeeld: Een volwassen tonijn legt een miljoen eitjes, waarvan uiteindelijk minder dan 10 individuen zich voortplanten. De rest sterft meestal jong.

10 Nu zijn we voorbereid om een viertal evolutionaire voorbeelden van antropogene selectie te bekijken.

11 3. Resistentie tegen infecties Wat? Niet vatbaar zijn voor een pathogeen (virus, bacterie of parasiet) Hoe? Natuurlijk (aangeboren en verworven immuunsysteem) of geïnduceerd met een behandeling Waar? Wereldwijd Eerste vermelding? Zo lang als er organismen bestaan Selectie

12 A. Antibiotica en resistentie: MRSA Wat? Methicilline-resistente Staphylococcus aureus bacterie (superbug). S. aureus komt bij 1/3 van de bevolking voor op huid en in neus. Vormt probleem indien in bloedbaan. Hoe? MRSA biedt weerstand aan meerdere antibiotica en ontwijkt antimicrobiële tussenproducten van de gastheer (zoals stikstofoxide - NO) Mortaliteit? 2 miljoen personen per jaar Historisch overzicht? Penicilline (Fleming; °1928); regelmatig gebruik sinds 1940. Resistentie sinds eind 1950. Methicilline (° 1959; eerste resistentie 1961). Resistentie is gevolg van tientallen jaren van onoor- deelkundig gebruik van antibiotica bij mens en dier. Belangrijk? Verhoogde medische uitgaven, verhoogde mortaliteit Selectie Science 2008

13 Genetische basis voor MRSA Bacteriën wisselen genetisch materiaal uit tussen chromosomen (stukuitwisseling). Maakt het mogelijk om nieuw genetisch materiaal en dus kenmerken te verwerven. In een medische omgeving met rijkelijk gebruik van antibiotica zullen “toevallig” resistente S. aureus een voetje voor hebben. Door geleidelijke aanrijking stapelen deze resistente stammen zich op  Survival of the fittest. Selectie

14 Enright et al. 2002 Resistentie in S. aureus vandaag Methycilline gevoelige S. aureus (MSSA) en MRSA komen samen voor. De evolutie van MRSA uit MSSA valt te traceren dmv sequentie bepaling. Evolutie leidde wereldwijd tot 11 MRSA clones verdeeld over 5 groepen van verwante genotypes (clonale complexen of CCs). CC5 en CC30 ontwikkelden zich wereldwijd uit ST5-MSSA (mecA = methicilline resistent gen). Pol, Slo, UK Fin, Ire, Jap, UK, USA Jap, USA Bel

15 Om te onthouden Gevolgen van (multi-)resistentie van pathogenen zijn wereldwijd merkbaar. Effect is meetbaar op niveau virulentie, specificiteit en polymorfisme Snelheid van verandering wordt bepaald door de selectiedruk (hoe meer kansen op selectie, hoe sneller selectie vordert). Selectie

16 Bestrijding van resistente pathogenen De perfectie bestaat niet (wapenwedloop!) Aangewezen is een combinatie van (geïntegreerde) strategieën aangepast aan ogenblik, plaats en intensiteit van infectie. Dat kan bestaan uit: - Aangepast gedrag en hygiëne (denk aan grieppreventie) - Geneesmiddelen onder vorm van cocktails (denk aan AIDS) - Voedingssupplementen bestaande uit levende bacteriën (promotie van goedaardige bactëriën) of niet-verteerbare voedingssupplementen die de groei van bacteriën bevorderen in het verteringssysteem (pro- en prebiotica) = Darwiniaanse geneeskunde  De toekomst ligt in onze handen…

17 B. Andere voorbeelden van resistentie Resistentie tegen infecties: Malaria (1 miljoen doden per jaar) : profylaxis: chloroquinine > mefloquine (Lariam) > …. Behandeling: pyrimethamine > artemisinin (maar ook tendens tot herverschijnen van infectiegevoeligheid) Schistosomiase (bilharziose – 280.000 doden per jaar in zwart Afrika) wordt veroorzaakt door Schistosoma platwormen; behandeld met Praziquantel sinds een tiental jaar. Er wordt gevreesd voor resistentie.. Resistentie tegen xenobiotica Pesticiden zoals DDT: rijkelijk en vaak onoordeelkundig gebruikt na WOII tot jaren tachtig. Halfwaarde tijd is 8 jaar. Vele insecten bouwden resistentie op door met glutathion transferasen (GSTs) DDT te detoxificeren; o.a. algemeen aangetroffen bij malaria Anopheles gambiae muggen.

18 4. Verstoorde soortvorming Wat? Soortvorming gebeurt progressief met “horten en stoten” Hoe? Isolatie van populaties in tijd en ruimte zodat rassen zich vormen. Rassen vormen de aanzet tot soortvorming. Waar? wereldwijd Wanneer? Sinds ontstaan levende organismen Belangrijk? Soortendiversiteit is motor van natuurlijke functies, goederen en diensten

19 Achtergrond bij het voorbeeld driedoornige stekelbaars Komt algemeen voor in noordelijk halfrond. Regelmatig evolueerden de originele mariene kustrassen tot lokale rassen: - bodem – open water (Vancouver) - trekkers – zoetwater (Lage Landen)

20 Gow et al. 2006 A. Vancouver: bodem – open water Driedoornige stekelbaars komt in Priest Lake voor in twee gescheiden groepen: bodem (benthisch) en open water (limnetisch). limnetisch benthisch Maar in Enos Lake is er een ineenstorting van het limnetische ras. Dit kan toegewezen worden aan ver- hoogde troebelheid (door toegenomen voedingsstoffen – eutrofiëring). Hybridisatie

21 A. Vancouver: bodem – open water Bodemvorm verkiest bodemprooien Openwater vorm eet zoöplankton. Door het verschil in voeding, gedraagt stekelbaars zich als “ecosysteem ingenieur” (Harmon et al. 2009) : Stekelbaars bepaalt ecosysteemstructuur, zeker voor zoöplankton biomassa (a), en minder voor benthische invertebraten biomassa (b).

22 A. Vancouver: bodem – open water Bodemvorm verkiest bodemprooien Openwater vorm eet zoöplankton. De voedingswijze koppelt dus terug naar het ecosysteem (engineering): - welke prooigemeenschap als voedsel? (  structuur) - algenproductie - opgeloste organische stoffen (turbiditeit) De gevolgen voor het ecosysteem zijn complex en onrechtstreeks. Onder andere: - cascade effecten - regimeverschuiving tussen twee alternatieve stabiele toestanden Scheffer et al. 2005

23 B. Andere voorbeelden van verstoorde soortvorming Darwinvinken: verliezen verschil in bekmorfologie door ongewilde tussenkomst van de mens Haplochromis cichliden : verliezen subtiele kleurverschillen door vertroebeling an het Victoriameer Boskortsteel Brachypodium sylvaticum verovert Noord-Amerika op basis van 3 introducties  Het fenomeen is zeer algemeen  De gevolgen voor het functioneren van het ecosysteem zijn serieus

24 5. Niet-duurzaam oogsten Wat? Visvangst en jacht Hoe? Evolutie van eenvoudige tot gesofisticeerde tuigen (geweer, sonar) Waar? Wereldwijd Intensiteit? Staat in verhouding tot bevolkingsdruk Selectie

25 A. Overbevissing - Zeevisserij is een belangrijk bron van eiwitten - Visserijdruk is gestegen proportioneel met de wereldbevolking - Op dit ogenblik importeert westerse bevolking in verhouding meer wildvang uit zuiderse oceanen

26 A. Overbevissing Overbevissing is algemeen. Verwacht wordt dat met het doorzetten van de huidige intensiteit onder hetzelfde beheer per 2046 de klassieke vissoorten zullen verdwenen zijn Garnaalvissers in de monding van de Yangtse rivier. Pauly et al. 2002

27 A. Overbevissing Heeft grote ecologische gevolgen: - Verdwijnen van grote vissen (toppredatoren) leidt tot verkorten van voedselketen - Verkorte voedselketen verstoort de trofische cascade - Leidt tot onverwachte gevolgen in zee: vergroenen, kwalbloei en exoten  regime shift (= instelling van een nieuw evenwicht)

28 A. Overbevissing In februari 2008 kreeg prof. Daniel Pauly een eredoctoraat aan de K.U.Leuven voor zijn inzet voor een duurzame visserij.

29 A. Overbevissing Heeft ook grote (en slecht gekende) evolutionaire gevolgen. Levensloop van vissen evolueert tussen paaigrond  kinderkamer  voedselgrond  paaigrond Visserijdruk treft de natuurlijke populaties niet willekeurig: - Grote vissen worden sneller gevangen (voedselgronden) - Volwassen vissen worden sneller gevangen (paaigronden) Dat leidt ofwel tot : - Tendens tot populaties met kleinere en jongere dieren (voedselgronden) - Tendens tot uitstellen van voortplanting (paaigronden)

30 I. Zonder visvangst: Goede groei en late maturatie II. Met visvangst: Late maturatie leidt tot verhoogde kans op vangen III. Met grotere visvangst: Visserijselectie bevordert vroege maturatie

31 Aanwijzingen

32 A. Overbevissing Naar een Darwiniaans visserijbeheer? - aangepaste vistechnieken - gesloten zones (paaigronden!) - gesloten seizoenen - responsabilisering

33 B. Andere voorbeelden van niet duurzaam oogsten - De jagers op vos in oostelijk Canada verkiezen de zilverkleurige variant. Over 100 jaar is het effect merkbaar (Allendorf en Hart, 2008). -Trofee jagers kiezen dieren met grote hoornen  Fenotypische veranderingen in geoogste systemen zijn sneller oiv de mens dan de natuurlijke veranderingen (Darimont et al. 2009)

34 6. Sporen van selectie bij de mens Toenemende wereldbevolking en verstedelijking leidt tot onverwachte effecten: - verhoogde kans op epidemieën en zoönosen (Mexicaanse griep, vogelgriep, SARS, …) - tekort aan beschikbare goederen (voedselaanbod, hout, (bouw)mineralen, …) - druk op beschikbare diensten (stofvrije lucht, ontspanning, …) - druk op beschikbare functies (zuurstof productie, remineralisatie, ….)

35 A. Lactose intolerantie – lactase persistentie Wat? Capaciteit tot verteren van lactose (suiker) Hoe? Lactase enzyme actief tijdens zoogperiode (< 5 jaar) Waar? In beperkt aantal bevolkingsgroepen (Afrikaanse herders en West- en Centraal-eU) gedurende volledige levenscyclus Vroegste verschijnen? In Europa 7500 jaar geleden (Bandkeramiek – vroeg Neoliticum) met overgang van gemengde economie naar veeteelt Eerste boeren brachten plantgoed uit Fertiele Sikkel (10.000-12.000 jaar geleden) in een minder geschikt gebied; overgang op melk betekent constante beschikbaarheid + zuivere vloeistof Belangrijk? Organisatie van gemeenschap… Selectie Thomas et al, 2009

36 B. Blijvende selectiedruk 100.000 JG: uitbreiding van habitatgebruik; grote subSahara bevolking 14.000 JG: opwarming na IJstijd 10.000 JG: jagers  herders (Fertiele Sikkel) >10.000 JG: bevolkingstoename (ziekte)  Grote selectiedruk Hawks et al. 2007

37 Voight et al. 2006 B. Blijvende selectiedruk Signaal van selectie is - sterk in alle populaties - regionaal (oa lactose in West-en Centraal Europa en NCOA1 gen voor vetzuursturing bij Afrikaanse Yoruba) en - wijst op lokale fenotypische adaptatie Selectie

38 Hawks et al. 2007 B. Blijvende selectiedruk Intensiteit van selectie is - sterk toegenomen over de laatste 40.000 jaar - grote bevolkingsgroepen genereren meer nieuwe mutaties, dus kansen voor selectie - deze groei sluit aan bij voorbije culturele en ecologische aanpassingen - wat leidt tot ongekend snelle genetische verandering van onze soort Selectie Van de 1800 menselijke genen onder recente selectiedruk wordt voor de West en Centraal-Europese groep een meer recente oorsprong geschat dan de Afrikaanse Yoruba.

39 C. Selectiedruk op voeding en ontwikkeling Wat? Metabolisme is aangepast aan voedingsregime Hoe? Selectie bevordert conservatieve omgang met calorieën (foutief bestempeld als thrifty fenotype - voordeel om aan gewicht te winnen en spaarzaam om te gaan met calorieën in een milieu waarin voedselaanbod wisselvallig is). Tussenkomst van reeks populatie- specifieke genen (o.a. vetzuursturing NCOA1 bij Yoruba en vetopname PPARD bij Europeanen). Waar? Wereldwijd (met uitschieters in zuid-pacifisch eiland van Palau) Betekenis? Maximalisatie van voedselopname Selectie

40 D. Andere voorbeelden van menselijke evolutie - Evolutie van immuunsysteem en allergieën - In vitro fertilisatie - Eugenetica (cfr Vrije Tribune in De Standaard 17 en 19.10.09) - Evolutie van taal en cultuur (zie presentatie van filosoof Andreas De Block) Prof. Jared Diamond ontving in oktober 2008 een eredoctoraat van de K.U.Leuven omwille van zijn onderzoek naar de geschiedenis van de mens over de laatste 13.000 jaar.

41 7. Waarom zou Darwiniaanse invloed meetellen? Duurzaamheid van biosfeer, inclusief mens Een aantal gevolgen van menselijke invloed zijn goed ingeschat. Maar het beeld blijft onvolledig. En gevolgen zijn vaak onverwacht (emergentie en zelf- organisatie) (Paul Ehrlich. Cultural evolution and the human predicament, 2009, Trends in Ecology en Evolution)

42 Hoe de Darwiniaanse invloed maatschappelijk in rekening brengen? Moeilijke vraag… Vereist een breder kader van denken en handelen. - Wat als ik minder vis vang en geen Darwiniaans deficit veroorzaak? - Wat als ik geen ongeval met slachtoffers veroorzaak? - Wat als ik van een vakantie thuis geniet en niet naar Turkije vlieg? Paul Ehrlich suggereert een gepast cultureel antwoord.

43 Er beweegt iets in onze maatschappij…. Zijn er vragen?

Download ppt "Leuven, 29 oktober 2009 Prof. Filip Volckaert, evolutiebioloog Departement Biologie, K.U.Leuven, De mens als evolutionaire knutselaar."

Verwante presentaties

Ads door Google