De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

Werkzitting II Prof. F. Claessens. Definities Escherichia coli Bacteriofaag Nucleosoom Attenuatie Promotor.

Verwante presentaties


Presentatie over: "Werkzitting II Prof. F. Claessens. Definities Escherichia coli Bacteriofaag Nucleosoom Attenuatie Promotor."— Transcript van de presentatie:

1 Werkzitting II Prof. F. Claessens

2 Definities Escherichia coli Bacteriofaag Nucleosoom Attenuatie Promotor

3 Wobble Nucleotide excision repair Leucine zipper

4 Een mRNA heeft 1, 2, 3 of 4 leesramen. Een DNA streng heeft 2, 4, 6 of 8 leesramen. Meerkeuzevragen: AUG GCC CAG GCU A

5 Een monomeer DNA-bindend domein contacteert meestal ongeveer_____ A. Één bpB. 12 bpsC. 6 bpsD. 2 bps Welke component staat in voor de herkenning van de ribosoom-bindingsplaatsen? A.eIFsB. tRNAiC. 23S rRNAD. 16S rRNA De regeling van de expressie van het lactose operon door een tekort aan glucose, wordt ___genoemd. A. De-repressieB. ActivatieC. AttenuatieD. Repressie

6 Welke van deze vier is GEEN codon voor Arginine? A.CGA B.CGU C.AGA D.AGU

7 Hieronder staat de sequentie van het eerste exon van een gen. Geef de eerste aminozuren van het eiwit dat hierdoor gekodeerd wordt GCCGGATATGCCAATATGCTTTCCCGGG… Duidt aan: 5’UTR3’UTR ORFStartcodon StopcodonRBS A B C D B C D B C D F E E E

8 GCCGGAU AUG CCA AUA UGC UUU CCC GGG…

9 Trp Met His His Lys Leu Ser Arg Leu Arg Uit een kleine hoeveelheid van een eiwit hebt u de volgende fragmenten kunnen identificeren: Ontwerp een oligonucleotide die als probe kan dienen om het mRNA dat voor dit eiwit te identificeren

10 Trp Met His His Lys Leu Ser Arg Leu Arg

11 Wat is het effect van deze mutatie? A.De insertie van één nucleotide nabij het einde van een mRNA B.Deletie van één nucleotide in de eerste twintig codons van een ORF C.Deletie van drie opeenvolgende nucleotiden middenin een ORF D.Een mutatie van de onderlijnde C in GCCGGAU’AUG’CCA’AUA’UGC… naar U, naar G naar A

12 AGGCTATATAATTTAAGCTAGATACCAGATAGATACCCCACCAA AAGTCATCAGTATAAAGATCAGATCAGGTCCCGAATTACGGTC TGTTCTTAACGAGTTATTCCCGCCGTAATACATGGTACCTGACA A.AGGCTATATAATT B.TAAGCTAGATACC C.ATTCGATCTATGG D.AATTATATAGCCTT A.TACATGGTACCTGACA B.ATTACGGCGGGAA C.TTCCCGCCGTAAT D.CAGGTACCATAGTA Het DNA fragment tussen de twee pijlen moet worden geamplificeerd. Welke DNA primers zou u daar voor nemen?


Download ppt "Werkzitting II Prof. F. Claessens. Definities Escherichia coli Bacteriofaag Nucleosoom Attenuatie Promotor."

Verwante presentaties


Ads door Google