De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

RFLP Restrictiefragment- lengte polymorfisme J. Smeets - A. Leen.

Verwante presentaties


Presentatie over: "RFLP Restrictiefragment- lengte polymorfisme J. Smeets - A. Leen."— Transcript van de presentatie:

1 RFLP Restrictiefragment- lengte polymorfisme J. Smeets - A. Leen

2 CGGAGGTGCGCATACTGACCGCGGTATACTAG GCCTCCACGCGTATGACTGGCGCCATATGATC DNA Restrictie-enzym zal DNA verknippen Principe

3 CGTATACT GCATATGA CGACCGCGGTATACTAGTCCT GCTGGCGCCATATGATCAGGA CGGAG GCCTC Een enzym zal bijvoorbeeld het DNA verknippen in het midden van de sequentie CT CG GA GC In dit geval ontstaan er 3 DNA-fragmenten met verschillende lengte, dus met een verschillend aantal basenparen. In de praktijk kan het aantal basenparen in 1 fragment zeer hoog zijn, bijvoorbeeld basenparen (bp). 8 basenparen21 basenparen5 basenparen

4 Elektroforese Referentiestaal met gekende DNA-fragmenten van bijvoorbeeld 10, 20 en 30 basenparen. Ons DNA-staal Negatief geladen Kleurstof putje

5 pool Elektroforese Ons DNA-staal + kleurstof pool Referentiestaal + kleurstof Kleurstof is negatief geladen en zal naar de positieve pool migreren. Alzo kan men op zicht het proces volgen. De DNA-fragmenten (die ook negatief geladen zijn) zullen ook migreren, maar deze fragmenten kunnen we niet zien!

6 Alzo kan men a.h.v. het referentiestaal het aantal basenparen van onze DNA-fragmenten schatten. DNA zichtbaar maken Ons DNA-staalReferentiestaal 30 basenparen 20 basenparen 10 basenparen ? basenparen RESULTAAT DNA wordt zichtbaar onder UV- licht

7 Alzo kan men patronen vergelijken en conclusies trekken. Voorzichtigheid is geboden! Toepassing 1: CRIMINOLOGIE Verdachte ABC DNA (vb. in bloed) aangetroffen op slachtoffer

8 Alzo kan men patronen vergelijken en hiermee bijvoorbeeld stofwisselingsziekten opsporen. Toepassing 2: ERFELIJKE ZIEKTEN OPSPOREN Gezond persoonPersoon met ziekte

9 Men vergelijkt soorten op erfelijke basis. Doel: mutaties zoeken en evolutielijnen opstellen. Toepassing 3: dier- of plantensoorten vergelijken Soort ASoort BSoort C 600 bp 300 bp 240 bp 10 bp600 bp 280 bp 240 bp 10 bp 400 bp 300 bp 240 bp 200 bp 10 bp basensubstitutie Deletie

10 Aansluitend practicum. Vliebergh Sencie 1999 Mutaties zoeken Werken met papieren DNA-modellen. Een schaar gebruiken als restrictie-enzyme. Mogelijke verklaringen geven voor deze mutaties: deletie, insertie, substitutie (inversie).

11 DNA-monsters worden behandeld met een bepaald enzym: restrictie-endonuclease. Hiervan zijn er nu al meer dan honderd verschillende bekend. Elk enzym herkent een welbepaalde opeenvolging van 4 tot 5 basen in het DNA en zal het DNA telkens ter hoogte van een dergelijke sequentie “doorknippen”. Daarom worden ze ook wel knipenzymen genoemd. Zo ontstaat voor elk behandeld DNA-monster een verzameling van fragmenten met verschillende lengte. Via elektroforese kan men dan deze fragmenten van elkaar scheiden.

12 Als er wijzigingen optreden (mutaties) in het DNA, zal de basenvolgorde anders zijn en kunnen er, na gebruik van restrictie-enzymen, fragmenten ontstaan die een andere lengte hebben. Alzo zullen de elektroforesebeelden er anders uitzien; er ontstaat een zogenoemd polymorfisme (veelvormigheid). Vandaar de naam van de methode: RESTRICTIEFRAGMENT-LENGTE POLYMORFISME. Gedurende de evolutie van een soort ontstaan er in het DNA mutaties, waardoor individuen ontstaan die genetisch verschillend zijn. Voorbeelden van mutaties zijn o.a. de omzetting van een base in een andere (basensubstitutie) of het bijkomen (insertie) of verdwijnen (deletie) van één of meerdere basen in het DNA.

13 Benodigdheden lange papieren strook waarop in grote letters de basenpaaropeenvolging van een kort dubbelstrengig DNA- molecule staat afgebeeld. scharen (= ‘knipenzymen’). blad papier.

14 Werkwijze leerlingen moeten zich als knipenzymen gedragen. Hiervoor overlopen zij de DNA-streng van links naar rechts en knippen het dubbelstrengig DNA- molecuul in het midden van een bepaalde herkenningssequentie door. Sommige leerlingen kunnen als knipenzym A functioneren, anderen als enzym B. Beiden hebben een andere herkenningssequentie. Alle DNA- moleculen worden met beide enzymen bewerkt. op een blad papier kan men een XY-assenkruis tekenen. Op de Y-as kunnen dan nummers (aantal basenparen) aangebracht worden, overeenkomend met de lengte van de fragmenten. Op de X-as kunnen bijvoorbeeld vier condities aangebracht worden (bv DNA I verknipt met enzym A, DNA II verknipt men enzym A, DNA I verknipt met enzym B, DNA II verknipt met enzym B) zoek mogelijke verklaringen voor de resultaten controleer je hypothesen (bv leg de fragmenten met 10 bp en 7 bp op de juiste manier achter elkaar en vergelijk met fragment met 17 bp)

15 Aantal bp DNA I knipenzym A DNA II knipenzym A DNA II knipenzym B DNA I knipenzym B Vergelijking DNA I en DNA II

16 Conclusie via vergelijking van de lengte van bepaalde fragmenten kan men bepaalde soorten mutaties als mogelijke oorzaken aangeven niet alle fragmenten met dezelfde lengte hebben noodzakelijk dezelfde basenvolgorde fragmenten met dezelfde lengte bevinden zich op eenzelfde plaats op het elektroforesebeeld

17


Download ppt "RFLP Restrictiefragment- lengte polymorfisme J. Smeets - A. Leen."

Verwante presentaties


Ads door Google