inhoud Situering Inleiding Proefopzet Resultaten en discussie Conclusie

Stageplaats Orbit Biotech – Mohali, India – Noorden van India Onderzoekscentra in Probiotica – Lactobacillus Plantarum – 2 weken training

Titel project Partial Characterization Bewegelijkheid van bacterie Biochemische testen Karakteristieke probiotische eigenschappen Genomic DNA amplification PCR en gelelektroforese

Titel project Optimization of plantaricin production from isolated Lactobacillus plantarum – Optimalisatie plantaracine productie – Aanwezige methode optimaliseren indien nodig

Wat zijn probiotica? “Goede of hulpvolle” bacteriën Gunstig effect gezondheid gastheer Darmflora Lactobacillus en Bifidobacterium Gram positieve en melkzuur producerende bacteriën

Probiotische voedsel bronnen Gefermenteerd voedsel – Yoghurt – Kaas – Yakult® Gastheer zelf – geboorte

Positieve effecten Irritable Bowel Syndrome (IBS) Reizigers of Antibiotisch-Geassocieerde diarree Helicobacter Pylori Vaginale infecties Huid infecties bij kinderen

Doel 1. Identificatie Lactobacillus plantarum – Karakteristieke eigenschappen Biochemische testen Probiotische eigenschappen – Erfelijk materiaal Species bevestigen via PCR

Doel 2. Hoe reageren pathogene bacteriën op plantaricine? – Antimicrobiële activiteit Well diffusie methode – Minimum Inhibitie Concentratie (MIC) Elisa reader

Beweeglijkheid van de bacterie Wet mount method Hanging drop method U-Tube method Cragie Tube method  NIET BEWEEGLIJK

Biochemische testen Resultaten zoals verwacht Uitzondering methylrood volgens bron

Biochemische testen Suikertest Sugar(s)Mean Standard Results LP1 Results LP2 Glucose+++ Xylose--- Sucrose+++ Fructose+++ Galactose+++ Lactose+++ Maltose+++ Trehalose+++ Rhamanose--- Mannitol+++ Melbiose--- Arabinose+++ Raffinose+++

Probiotische eigenschappen Thermal Death point (TDP) – Temperatuur waarbij organisme sterft binnen de 10 min 50 graden voor LP1 en LP2 Thermal Death Time (TDT) – tijdsduur nodig om het organisme te doden bij een welbepaalde temperatuur 19 minuten voor LP1 en LP2

Probiotische eigenschappen Acid tolerance – Nagaan bij welke pH het organisme kan overleven pH 3 Bile tolerance – Nagaan bij hoeveel procent gal het organisme kan overleven 2-9 %

Genetische materiaal Primers – Forward primer : Lac16S-for AATGAGAGTTTGATCCTGGCT – Reverse primer : Lac16S-rev GAGGTGATCCAGCCGCAGGTT

Bacteriocine extractie van Lactobacillus plantarum Peptiden geproduceerd door een bacterie dat een bacteriedodende werking geeft tegenover niet verwante bacteriën Groei dag 1-5

Antimicrobiële activiteit Welldiffusie methode MicrococcusS. typhi C. AlbicansE. faecalis S. EpidermidisS. aureus K. PneumoniaE. coli B. subtilisV. cholera

Antimicrobiële activiteit

Minimum Inhibitie Concentratie Laagste concentratie plantaricine nodig om bacterie te doden ELISA reader – Groei in titerwell platen A 100 µL pathogen µL bacteriocin (1:1) B 100 µL pathogen µL Mueller Hinton Broth µL bacteriocin (1:2) C100 µL pathogen µL Mueller Hinton Broth (1:4) D100 µL pathogen µL Mueller Hinton Broth (1:8) E100 µL pathogen µL Mueller Hinton Broth (1:16) F100 µL pathogen µL Mueller Hinton Broth (1:32) G100 µL pathogen µL Mueller Hinton Broth (1:64) H100 µL pathogen µL Mueller Hinton Broth (control)

Minimum Inhibitie Concentratie Gemiddelde : ¼ Uitzondering – C.albicans : ½ – E.faecalis : 1/8 LP1LP2 K. pneumoniaDag 1Dag 2 Dag 3Dag 4Dag 5Dag 1Dag 2Dag 3Dag 4Dag 5 A0,7300,7710,9460,8360,7710,7220,7660,9140,8140,787 B0,8110,8130,8370,8270,8440,8040,8160,8670,8200,814 C1,4691,4201,4681,4481,3261,4701,4531,4781,4581,346 D1,4871,1531,5301,4331,4311,4811,4491,5011,4631,433 E1,4211,4021,4321,4211,4031,4201,4261,4461,4401,296 F1,3361,3781,4011,3811,3701,3211,3761,4451,4341,288 G1,1241,1861,3461,3671,1101,1221,1891,3761,3751,114 H1,4121,3981,4021,3351,3921,4101,3721,3471,4121,335

Conclusie Onderzochte stock cultuur is Lactobacillus plantarum Verder onderzoek verreist Experimenten herhalen  Goede eigenschappen probiotica

Toekomst perspectief Geschikte eigenschappen – Gebruik voedingsindustrie – Gebruik geneesmiddelen

Biochemische testen Indole testMethyl Red test Voges Proskaeur test Citrate utilization test Triple Sugar Iron agar