De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

DEEL 3 Gentisch materiaal en celdelingen Genexpressie Thema 7.

Verwante presentaties


Presentatie over: "DEEL 3 Gentisch materiaal en celdelingen Genexpressie Thema 7."— Transcript van de presentatie:

1 DEEL 3 Gentisch materiaal en celdelingen Genexpressie Thema 7

2 Het leven van een cel in een notendop 1 1 Celyclus: interfase gevolgd door celdeling Vereenvoudigde voorstelling van de celcyclus van een levercel

3 Chromatine DNA Histonen Chromatine tijdens de interfase Chemische samenstelling van DNA

4 DNA D esoxyribo N ucleïne A cid is een polynucleotide Eén nucleotide bestaat uit:  Desoxyribose  Fosfaatgroep  Organische stikstofbase  Adenine (A)  Cytosine (C)  Guanine (G)  Thymine (T)

5 Structuur van de suikermolecule en de fosfaatgroep

6 Structuur van de organische stikstofbasen

7 2.2Ruimtelijke structuur van DNA Crick & Watson Maurice Wilkins Rosalind Franklin 1953

8 Dubbele helix: 2 suiker-fosfaatruggengraten Complementaire structuur: A T C G Antiparallele structuur: 5’  3’ 3’  5’ Basensequentie: = genetische informatie

9 2.3Verband tussen DNA en gen GEN = DNA-fragment met de code voor de aanmaak van een polypeptide

10 2.4Histonen Proteïne Ondersteunende rol Regulerende rol bij genexpressie Opwinden van DNA: DNA heeft totale lengte van 2m  past in kern met Ø van 2µm

11 2.5Structuur van een chromatinevezel Chromatinevezel = DNA + histonen  ‘parelsnoer’ euchromatineheterochromatine genexpressie is mogelijk geen genexpressie

12 Chemische samenstelling + ruimtelijke structuur RNA Chemische samenstelling van RNA Nucleïnezuur, opgebouwd uit nucleotiden  Ribose (ipv. desoxyribose)  Fosfaatgroep  Organische stikstofbase Cytosine Guanine Adenine Uracil  ipv. thymine bij DNA

13 3.2Ruimtelijke structuur van RNA Enkelstrengig Oriëntatie 5’  3’ Kan ruimtelijk opgevouwen zijn door basenparing

14 Genexpressie 4 4 Gen  Polytpeptide  Proteïne  

15 Centrale hypothese v. moleculaire biologie 5 5

16 Verloop van de proteïnesynthese 6 6

17 In de kern bevinden zich DNA-moleculen die de genetische codes bevatten voor de erfelijke kenmerken. Bij de mens vinden we er 46 DNA-moleculen per cel. KERN DNA CYTOPLASMA

18 DNA CYTOPLASMAKERN In de kern bevinden zich DNA-moleculen, waarvan er hier één is afgebeeld. Het is een dubbelstreng (helix). De DNA-helix ontplooit zich op de plaats waar de genetische codes liggen voor de aanmaak van een bepaald eiwit. Messenger-RNA (boodschapper-RNZ voor een bepaald eiwit) wordt gemaakt, overeenkomstig met de DNA-codes. m-RNA

19 DNA CYTOPLASMAKERN m-RNA wordt losgekopppeld van DNA en de DNA-helix sluit zich weer. m-RNA

20 m-RNA verlaat de celkern via de kernporiën.

21 m-RNA schuift in ribosomen binnen. Ruw endoplasmatisch reticulum Ribosoom m-RNA KERN

22 De eiwitten kunnen terecht komen in het endoplasmatisch reticulum. Ruw endoplasmatisch reticulum Ribosoom m-RNA Eiwit KERN

23 De eiwitten kunnen de cel verlaten. Ruw endoplasmatisch reticulum Ribosoom m-RNA Eiwit KERN

24

25 6.1

26 DNA Benodigdheden ATGGTATGAATATATACGAAAACACCCTTAA  Knipenzym X m-RNA-polymerase TACCATACTTATATATGCTTTTGTGGGAATT  Knipenzym Y

27 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT DNA bestaat uit een aaneenschakeling van nucleotiden (Nucleotide = desoxyribose + fosfaat + organische base). Alleen de organische basen zijn afgebeeld.  Waterstofbruggen worden verbroken.3 waterstofbruggen tussen Guanine en Cytosine 2 waterstofbruggen tussen Adenine en Thymine

28 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT precursor messenger-RNA m-RNA-polymerase schuift over DNA-enkelstreng en maakt primair m-RNA via een polymerisatieproces. AUGGUAUGAAUAUAUACGAAAACACCGUUAA

29 ATGGTATGAATATATACGAAAACACCCTTAA AUGGUAUGAAUAUAUACGAAAACACCGUUAA  TACCATACTTATATATGCTTTTGTGGGAATT precursor messenger-RNA

30 ATGGTATGAATATATACGAAAACACCCTTAA AUGGUAUGAAUAUAUACGAAAACACCGUUAA TACCATACTTATATATGCTTTTGTGGGAATT

31 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA precursor messenger-RNA

32 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA DNA precursor messenger-RNA

33 AUGGUAUGAAUAUAUACGAAAACACCGUUAA precursor messenger-RNA  Splicing Bepaalde stukken zullen uit dit RNA geknipt worden door bepaalde enzymen. Dit proces heet splicing. Alzo wordt precursor messenger-RNA het uiteindelijke messenger- RNA (mRNA).

34 UGAA precursor messenger-RNA AUGGUA Intron ExonExon = Expressed region UAUAUACGAAAACACCGUUAA

35 AUGGUACGAAAACACCGUUAA messenger-RNA m-RNA bestaat uit aan elkaar geschakelde nucleotiden (nucleotide = ribose + fosfaat + organische base). De organische basen zijn: U: uracil (i.p.v. thymine bij DNA) A: adenine G: guanine C: cytosine

36

37 AUG GUA CGA AAA CAC CGU UAA m-RNA ribosoom t-RNA Benodigdheden RF RF = Release Factor 30 S 50 S Anti-codon Codon Aminozuur

38 mRNA-codons >> aminozuur

39 Andere voorstelling: aflezen van binnen naar buiten. 5’  3’

40 Transfer-RNA (tRNA)  Elk tRNA bezit een anticodon (triplet) dat complementair is met een codon (triplet) van het mRNA  Elk tRNA heeft een bindplaats voor een aminozuur (3’)

41

42

43 AUG GUA CGA AAA CAC CGU UAA AUG = startcodon UAA = stopcodon Valine Arginine Lysine Histidine Arginine Methionine Een codon (triplet) komt overeen met een bepaald aminozuur of duidt start en stop aan.

44 AUG GUA CGA AAA CAC CGU UAA AUG = startcodon Het m-RNA zal doorheen het ribosoom schuiven om de codons (3 basen) af te lezen en te vertalen in de overeenstemmende aminozuren, die aangebracht worden door t-RNA. Deze aminozuren worden aan elkaar gekoppeld tot een eiwit. Met Val Translatie: in 5’ 3’ richting van mRNA

45 AUG GUA CGA AAA CAC CGU UAA MetVal

46 AUG GUA CGA AAA CAC CGU UAA Val Met

47 AUG GUA CGA AAA CAC CGU UAA Met Val Arg

48 AUG GUA CGA AAA CAC CGU UAA Met Val Arg

49 AUG GUA CGA AAA CAC CGU UAA Met Val Lys Arg

50 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys

51 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His

52 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His

53 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His Arg

54 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His Arg

55 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg

56 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg

57 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg

58 AUG GUA CGA AAA CAC CGU UAA RF EIWIT t-RNA-molecylen worden weer voorzien van hun juiste aminozuren Met ValArg Lys His Arg

59 EIWIT Methionine Valine Arginine Lysine Histidine Arginine Methionine kan afgeknipt worden.

60 m-RNA codons  Aminozuur UAA  Stop CGU  Arginine CAC  Histidine AAA  Lysine CGA  Arginine GUA  Valine AUG  Methionine / Start EIWIT Aan elkaar geschakelde aminozuren Arginine Histidine Valine Lysine Arginine

61 Voorbeeld in het handboek (p. 178 …)  Synthese van de proteïne oxytocine (hormoon) Contractie baarmoeder tijdens de bevalling Contractie baarmoeder na bevalling Contractie spiertjes rond de melkklieren  Aanmaak in de hypothalamus

62 transcriptie

63 5’ GAGGGGAAAUCUGAUGUGCUACAUACAGAACUGUCCCCUCGGCUAG 3’ Volledige mRNA voor oxytocine De eerste nucleotiden voor het startcodon AUG worden niet vertaald in aminozuren. De translatie begint dus vanaf het startcodon AUG (vorming van het startcomplex). translatie

64 Binding van aminozuren aan specifieke tRNA’s door enzymen.

65 5’ AUG UGC UAC AUA CAG AAC UGU CCC CUC GGC UAG 3’ Vorming van het startcomplex

66 5’ AUG UGC UAC AUA CAG AAC UGU CCC CUC GGC UAG 3’ Met Cys Tyr Ile Gln Asn Cys Pro Leu Gly Stop

67

68 Einde van de translatie: stopcodon (UAG)  release factor (RF) Methionine wordt afgeknipt + transport naar golgicomplex

69 Parelsnoer van ribosomen op één mRNA-streng 6.3.5Vorming van polysomen

70 6.4Overzicht verloop proteïnesynthese de basensequentie van het DNA-fragment (gen) voor oxytocine de basensequentie van een mRNA een aminozuursequentie in een polypeptide de functionele proteïne oxytocine Voorbeeld : vorming van oxytocine transcriptie in de celkern translatie in het cytosol opvouwing van de polypeptide

71

72

73 Primaire eiwitstructuur De aminozuurvolgorde van het eiwit

74 Secundaire eiwitstructuur Ontstaat als de aminozuren zich ordenen in een alfa-helix of een beta-sheet Waterstofbruggen!

75 Tertiaire eiwitstructuur Ontstaat als alfa-helices of een beta-sheets zich vouwen tot een complexe 3-dimensionele structuur. Waterstofbruggen en disulfidebruggen

76 Quarternaire eiwitstructuur Ontstaat als 2 of meer peptiden samen een eiwit vormen. Vb: hemoglobine

77 https://www.youtube.com/watch?v=7D6EqlL5VsA https://www.youtube.com/watch?v=5wMqHOf692E https://www.youtube.com/watch?v=nHM4UUVHPQM&spfreload=1www.youtube.com/watch?v=nHM4UUVHPQM&spfreload=1 https://www.youtube.com/watch?v=M568QP1K3sM Animaties eiwitsynthese


Download ppt "DEEL 3 Gentisch materiaal en celdelingen Genexpressie Thema 7."

Verwante presentaties


Ads door Google