De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

Thema 7 Genexpressie DEEL 3 Gentisch materiaal en celdelingen.

Verwante presentaties


Presentatie over: "Thema 7 Genexpressie DEEL 3 Gentisch materiaal en celdelingen."— Transcript van de presentatie:

1 Thema 7 Genexpressie DEEL 3 Gentisch materiaal en celdelingen

2 1 Het leven van een cel in een notendop
Celyclus: interfase gevolgd door celdeling Vereenvoudigde voorstelling van de celcyclus van een levercel

3 2 2.1 Chemische samenstelling van DNA Chromatine Histonen
Chromatine tijdens de interfase 2 2.1 Chemische samenstelling van DNA Chromatine DNA Histonen

4 DNA DesoxyriboNucleïneAcid
is een polynucleotide Eén nucleotide bestaat uit: Desoxyribose Fosfaatgroep Organische stikstofbase Adenine (A) Cytosine (C) Guanine (G) Thymine (T)

5 Structuur van de suikermolecule en de fosfaatgroep

6 Structuur van de organische stikstofbasen

7 Maurice Wilkins Crick & Watson Rosalind Franklin 1953
2.2 Ruimtelijke structuur van DNA 1953 Maurice Wilkins Crick & Watson Rosalind Franklin

8 A T C G Dubbele helix: 2 suiker-fosfaatruggengraten
Complementaire structuur: A T C G Antiparallele structuur: 5’  3’ 3’  5’ Basensequentie: = genetische informatie

9 2.3 Verband tussen DNA en gen
GEN = DNA-fragment met de code voor de aanmaak van een polypeptide

10 2.4 Histonen Proteïne Ondersteunende rol
Regulerende rol bij genexpressie Opwinden van DNA: DNA heeft totale lengte van 2m  past in kern met Ø van 2µm

11 genexpressie is mogelijk
2.5 Structuur van een chromatinevezel Chromatinevezel = DNA + histonen  ‘parelsnoer’ euchromatine heterochromatine genexpressie is mogelijk geen genexpressie

12 3 3.1 Chemische samenstelling van RNA
Chemische samenstelling ruimtelijke structuur RNA 3 3.1 Chemische samenstelling van RNA Nucleïnezuur, opgebouwd uit nucleotiden Ribose (ipv. desoxyribose) Fosfaatgroep Organische stikstofbase Cytosine Guanine Adenine Uracil  ipv. thymine bij DNA

13 3.2 Ruimtelijke structuur van RNA
Enkelstrengig Oriëntatie 5’  3’ Kan ruimtelijk opgevouwen zijn door basenparing

14 Genexpressie 4 Gen Polytpeptide Proteïne

15 Centrale hypothese v. moleculaire biologie
5 Eiwitsynthese DNA >>>>>>> m-RNA>>>>>>> eiwit Transcriptie Translatie

16 Verloop van de proteïnesynthese
6

17 In de kern bevinden zich DNA-moleculen die de genetische codes bevatten voor de erfelijke kenmerken. Bij de mens vinden we er 46 DNA-moleculen per cel. KERN CYTOPLASMA DNA

18 Messenger-RNA (boodschapper-RNZ voor een bepaald eiwit) wordt gemaakt, overeenkomstig met de DNA-codes. De DNA-helix ontplooit zich op de plaats waar de genetische codes liggen voor de aanmaak van een bepaald eiwit. In de kern bevinden zich DNA-moleculen, waarvan er hier één is afgebeeld. Het is een dubbelstreng (helix). CYTOPLASMA KERN DNA m-RNA

19 m-RNA wordt losgekopppeld van DNA en de DNA-helix sluit zich weer.
CYTOPLASMA KERN DNA m-RNA

20 m-RNA verlaat de celkern via de kernporiën.

21 m-RNA schuift in ribosomen binnen.
Ribosoom m-RNA KERN Ruw endoplasmatisch reticulum

22 De eiwitten kunnen terecht komen in het endoplasmatisch reticulum.
Ribosoom KERN m-RNA Eiwit Ruw endoplasmatisch reticulum

23 De eiwitten kunnen de cel verlaten.
Ribosoom KERN m-RNA Eiwit Ruw endoplasmatisch reticulum

24 Eiwitsynthese DNA >>>>>>> m-RNA>>>>>>> eiwit Transcriptie speelt zich af in de kern Translatie speelt zich af in het cytoplasma

25 6.1

26  Knipenzym X  Knipenzym Y TACCATACTTATATATGCTTTTGTGGGAATT
Benodigdheden DNA TACCATACTTATATATGCTTTTGTGGGAATT ATGGTATGAATATATACGAAAACACCCTTAA m-RNA-polymerase  Knipenzym X  Knipenzym Y

27 Waterstofbruggen worden verbroken.
DNA bestaat uit een aaneenschakeling van nucleotiden (Nucleotide = desoxyribose + fosfaat + organische base). Alleen de organische basen zijn afgebeeld. Waterstofbruggen worden verbroken. TACCATACTTATATATGCTTTTGTGGGAATT 3 waterstofbruggen tussen Guanine en Cytosine 2 waterstofbruggen tussen Adenine en Thymine ATGGTATGAATATATACGAAAACACCCTTAA

28 precursor messenger-RNA
m-RNA-polymerase schuift over DNA-enkelstreng en maakt primair m-RNA via een polymerisatieproces. TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA precursor messenger-RNA ATGGTATGAATATATACGAAAACACCCTTAA

29 precursor messenger-RNA
TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA precursor messenger-RNA ATGGTATGAATATATACGAAAACACCCTTAA

30 TACCATACTTATATATGCTTTTGTGGGAATT
AUGGUAUGAAUAUAUACGAAAACACCGUUAA ATGGTATGAATATATACGAAAACACCCTTAA

31 precursor messenger-RNA
TACCATACTTATATATGCTTTTGTGGGAATT ATGGTATGAATATATACGAAAACACCCTTAA precursor messenger-RNA AUGGUAUGAAUAUAUACGAAAACACCGUUAA

32 precursor messenger-RNA
DNA TACCATACTTATATATGCTTTTGTGGGAATT ATGGTATGAATATATACGAAAACACCCTTAA precursor messenger-RNA AUGGUAUGAAUAUAUACGAAAACACCGUUAA

33 precursor messenger-RNA
Bepaalde stukken zullen uit dit RNA geknipt worden door bepaalde enzymen. Dit proces heet splicing. Alzo wordt precursor messenger-RNA het uiteindelijke messenger-RNA (mRNA). AUGGUAUGAAUAUAUACGAAAACACCGUUAA Splicing

34 precursor messenger-RNA
Exon Exon = Expressed region AUGGUA UAUAUACGAAAACACCGUUAA UGAA Intron

35 AUGGUACGAAAACACCGUUAA
messenger-RNA m-RNA bestaat uit aan elkaar geschakelde nucleotiden (nucleotide = ribose + fosfaat + organische base). AUGGUACGAAAACACCGUUAA De organische basen zijn: U: uracil (i.p.v. thymine bij DNA) A: adenine G: guanine C: cytosine

36 6.2 + 6.3 Translatie Translatie: vertaling van m-RNA tot eiwit.
Hoe worden eiwitten gemaakt?

37 AUG GUA CGA AAA CAC CGU UAA
Benodigdheden m-RNA Codon Codon Codon Codon Codon Codon Codon AUG GUA CGA AAA CAC CGU UAA RF RF = Release Factor Anti-codon t-RNA UAC CAU GCU ribosoom Aminozuur 30 S UUU GUG GCA 50 S

38 mRNA-codons >> aminozuur

39 Andere voorstelling: aflezen van binnen naar buiten. 5’  3’

40 Transfer-RNA (tRNA) Elk tRNA bezit een anticodon (triplet) dat complementair is met een codon (triplet) van het mRNA Elk tRNA heeft een bindplaats voor een aminozuur (3’)

41

42

43 AUG GUA CGA AAA CAC CGU UAA
Een codon (triplet) komt overeen met een bepaald aminozuur of duidt start en stop aan. AUG GUA CGA AAA CAC CGU UAA UAA = stopcodon Arginine Histidine Lysine Arginine Valine Methionine AUG = startcodon

44 AUG GUA CGA AAA CAC CGU UAA
AUG = startcodon AUG GUA CGA AAA CAC CGU UAA UAC Met CAU Val Het m-RNA zal doorheen het ribosoom schuiven om de codons (3 basen) af te lezen en te vertalen in de overeenstemmende aminozuren, die aangebracht worden door t-RNA. Deze aminozuren worden aan elkaar gekoppeld tot een eiwit. Translatie: in 5’ ’ richting van mRNA

45 AUG GUA CGA AAA CAC CGU UAA
CAU Val Met

46 AUG GUA CGA AAA CAC CGU UAA
CAU UAC Val Met

47 AUG GUA CGA AAA CAC CGU UAA
CAU GCU Arg UAC Val Met

48 AUG GUA CGA AAA CAC CGU UAA
CAU GCU UAC Arg Val Met

49 AUG GUA CGA AAA CAC CGU UAA
GCU UUU Lys CAU UAC Arg Val Met

50 AUG GUA CGA AAA CAC CGU UAA
GCU UUU CAU UAC Lys Arg Val Met

51 AUG GUA CGA AAA CAC CGU UAA
UUU GUG His GCU CAU UAC Lys Arg Val Met

52 AUG GUA CGA AAA CAC CGU UAA
UUU GUG GCU CAU UAC His Lys Arg Val Met

53 AUG GUA CGA AAA CAC CGU UAA
GUG GCA Arg UUU GCU CAU His UAC Lys Arg Val Met

54 AUG GUA CGA AAA CAC CGU UAA
GUG GCA UUU GCU CAU Arg UAC His Lys Arg Val Met

55 AUG GUA CGA AAA CAC CGU UAA
RF GCA GUG UUU GCU Arg CAU His UAC Lys Arg Val Met

56 AUG GUA CGA AAA CAC CGU UAA
RF GCA GUG UUU GCU CAU Arg UAC His Lys Arg Val Met

57 AUG GUA CGA AAA CAC CGU UAA
GCA GUG UUU GCU RF CAU Arg UAC His Lys Arg Val Met

58 AUG GUA CGA AAA CAC CGU UAA
CAU GCU RF t-RNA-molecylen worden weer voorzien van hun juiste aminozuren UUU GUG GCA EIWIT Arg His Lys Val Arg Met

59 EIWIT Arginine Histidine Methionine kan afgeknipt worden. Lysine
Valine Arginine Methionine

60 Aan elkaar geschakelde aminozuren
EIWIT Aan elkaar geschakelde aminozuren m-RNA codons  Aminozuur UAA  Stop CGU  Arginine CAC Histidine AAA  Lysine CGA  Arginine GUA  Valine AUG  Methionine / Start Arginine Histidine Valine Lysine

61 Voorbeeld in het handboek (p. 178 …)
Synthese van de proteïne oxytocine (hormoon) Contractie baarmoeder tijdens de bevalling Contractie baarmoeder na bevalling Contractie spiertjes rond de melkklieren  Aanmaak in de hypothalamus

62 transcriptie

63 translatie Volledige mRNA voor oxytocine
5’ GAGGGGAAAUCUGAUGUGCUACAUACAGAACUGUCCCCUCGGCUAG 3’ De eerste nucleotiden voor het startcodon AUG worden niet vertaald in aminozuren. De translatie begint dus vanaf het startcodon AUG (vorming van het startcomplex).

64 Binding van aminozuren aan specifieke tRNA’s door enzymen.

65 Vorming van het startcomplex
5’ AUG UGC UAC AUA CAG AAC UGU CCC CUC GGC UAG 3’ Vorming van het startcomplex

66 Met Cys Tyr Ile Gln Asn Cys Pro Leu Gly Stop
5’ AUG UGC UAC AUA CAG AAC UGU CCC CUC GGC UAG 3’ Met Cys Tyr Ile Gln Asn Cys Pro Leu Gly Stop

67

68 Einde van de translatie: stopcodon (UAG)
release factor (RF) Methionine wordt afgeknipt + transport naar golgicomplex

69 6.3.5 Vorming van polysomen Parelsnoer van ribosomen op één mRNA-streng

70 6.4 Overzicht verloop proteïnesynthese
Voorbeeld : vorming van oxytocine de basensequentie van het DNA-fragment (gen) voor oxytocine transcriptie in de celkern de basensequentie van een mRNA translatie in het cytosol een aminozuursequentie in een polypeptide opvouwing van de polypeptide de functionele proteïne oxytocine

71

72

73 Primaire eiwitstructuur
De aminozuurvolgorde van het eiwit

74 Secundaire eiwitstructuur
Ontstaat als de aminozuren zich ordenen in een alfa-helix of een beta-sheet Waterstofbruggen!

75 Tertiaire eiwitstructuur
Ontstaat als alfa-helices of een beta-sheets zich vouwen tot een complexe 3-dimensionele structuur. Waterstofbruggen en disulfidebruggen

76 Quarternaire eiwitstructuur
Ontstaat als 2 of meer peptiden samen een eiwit vormen. Vb: hemoglobine

77 Animaties eiwitsynthese
https://www.youtube.com/watch?v=M568QP1K3sM https://www.youtube.com/watch?v=5wMqHOf692E https://www.youtube.com/watch?v=7D6EqlL5VsA https://www.youtube.com/watch?v=nHM4UUVHPQM&spfreload=1


Download ppt "Thema 7 Genexpressie DEEL 3 Gentisch materiaal en celdelingen."

Verwante presentaties


Ads door Google