De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

Analysetechnieken a. DNA-isolatie b. DNA-amplificatie: PCR c. Amplicon-detectie: gelectroforese Module: PCR analyse en Gelelectroforese 1 PCR MOLGEN2.

Verwante presentaties


Presentatie over: "Analysetechnieken a. DNA-isolatie b. DNA-amplificatie: PCR c. Amplicon-detectie: gelectroforese Module: PCR analyse en Gelelectroforese 1 PCR MOLGEN2."— Transcript van de presentatie:

1 Analysetechnieken a. DNA-isolatie b. DNA-amplificatie: PCR c. Amplicon-detectie: gelectroforese Module: PCR analyse en Gelelectroforese 1 PCR MOLGEN2

2 PCR Wat is PCR? Staat voor Polymerase Chain Reaction Ontwikkeld door de Amerikaan Karry Mullis (1983). Nobelprijs gekregen. Wat doet PCR? Gedeelte van het (deels) bekende genoom vermeerderen (miljarden kopieen) Toepassingen: snelle detectie van ziekteverwekkers, genen, afwijkende DNAfragmenten etc. Module: PCR analyse en Gelelectroforese 2 PCR analyse1

3 We zoeken het rode gen:..AGCGCGCGCTTTCTCCTCGATCAGTCATCG....TCGCGCGCGAAAGAGGAGCTAGTCAGTAGC.. We willen een techniek die alleen het rode gen doet verdubbelen en niet ál het DNA:..AGCGCGCGCTTTCTCCTCGATCAGTCATCG..  AGTA CGCT ..TCGCGCGCGAAAGAGGAGCTAGTCAGTAGC.. Leidt tot:..AGCGCGCGCTTTCTCCTCGATCAGTCATCG.. TCGCGCGCGAAAGAGGAGCTAGTCAGTA CGCTTTCTCCTCGATCAGTCATCG..TCGCGCGCGAAAGAGGAGCTAGTCAGTAGC.. Module: PCR analyse en Gelelectroforese 3 PCR analyse1

4 En dat leidt tot:..AGCGCGCGCTTTCTCCTCGATCAGTCATCG.. TCGCGCGCGAAAGAGGAGCTAGTCAGTA CGCTTTCTCCTCGATCAGTCAT TCGCGCGCGAAAGAGGAGCTAGTCAGTA CGCTTTCTCCTCGATCAGTCATCG GCGAAAGAGGAGCTAGTCAGTA CGCTTTCTCCTCGATCAGTCATCG..TCGCGCGCGAAAGAGGAGCTAGTCAGTAGC.. Na 40 stappen heb je ca 2^40 van dit soort fragmenten. Module: PCR analyse en Gelelectroforese 4 PCR analyse1

5 De Techniek. Deze methode verlangt een paar ingredienten: 1. Er is maar heel weinig DNA nodig. 2. Aanwezige primers (stukjes DNA van 20 bp lang). 3. Losse nucleotiden (een mengsel van dNTP’s) 4. DNA-polymerase (Hittebestendige versie van het enzym dat nucleotiden aan het enkele DNA vasthecht) 5. Omgevingsfactoren (MgCl2), Water ed. Module: PCR analyse en Gelelectroforese 5 PCR analyse1

6 Hoe werkt het principe? Bij hoge temperatuur smelten de DNA strengen en raken uiteen (98 graden C) Dan hechten zich korte apart vervaardigde stukjes enkelstrengs DNA (zgn primers) (bij een bepaalde temp. Hierna koppelt DNApol er losse nucleotiden aan, en maakt de nieuwe strengen af. Deze drie stappen herhaal je 30-40x. Tenslotte koelt het geheel weer af,en heb je enorme hoeveelheid van gekopieerd fragment DNA. Module: PCR analyse en Gelelectroforese 6 PCR analyse1

7 1a gewone dubbelstrengs DNA 1b DNA Smelt bij 98 graden 1c bij ca 50 graden hechten primers 1d bij 72 graden worden deze aangevuld met losse nucleotiden door enzym Taq-DNApolymerase (Taq -= Thermo aquatic) 2b Opnieuw smelt bij 98 graden Module: PCR analyse en Gelelectroforese 7 PCR analyse1

8 2c bij ca 50 graden hechten primers 2d Polymerase knoopt er opnieuw losse nucleotiden aan en verlengt de streng tot het einde. (Bij 72 graden) 3b Opnieuw smelt bij 98 graden voor ronde 3…. Etc etc etc.. Module: PCR analyse en Gelelectroforese 8 PCR analyse1

9 Wat valt op? Elke ronde verdubbelt het aantal korte fragmenten. Dus na 40 rondes heb je in principe 2 40 fragmenten. Het aantal grote strengen blijft gelijk Het aantal ‘halve’ strengen neemt elke stap lineair toe. Na 40 ronden is het aantal korte fragmenten dermate talrijk dat zij voor het blote oog kunnen worden aangetoond. (Gel-electroforese). Module: PCR analyse en Gelelectroforese 9 PCR analyse1

10 Wat is de werkwijze in de praktijk? A) We moeten DNA zien te halen uit de cellen van het organisme dat we onderzoeken. (plant) B) Hiervan is maar heel weinig DNA nodig C) We voegen de ingredienten voor replicatie toe: water DNA-nucleotiden primers Taq-DNA-polymerase (enzym) zouten ed. D) Dit mengsel doorloopt een herhaald traject van temperaturen (98 graden, 50 graden, 72 graden). E) Tenslotte is het mengsel verrijkt met korte fragmentjes. (Zó talrijk dat de rest nauwelijks meetelt..) Module: PCR analyse en Gelelectroforese 10 PCR analyse1

11 1. Epje 0.2 ml met verdunningsbuffer 2. Voeg 2 mm 2 blad toe 3. Crush met pipetpunt 4. Centrifugeer 5. Neem supernatant over in schoon epje 6. Voeg toe: Primers dNTP’s, Mgcl2 mengsel DNA polymerase Water En dan….IN DE PCR! Module: PCR analyse en Gelelectroforese 11 PCR analyse1

12 1. Verwarmd deksel 2. Ruimte voor de epjes (0.2 ml) 96 stuks maximaal 3. Aparte instructie aanwezig. 4. Bedieningspaneel Module: PCR analyse en Gelelectroforese 12 PCR analyse1 PCR: Techne CYCLOGENE 1.Ruimte voor 96 epjes 2.Verwarmd deksel voorkomt verdamping.

13 Zorg dat je alles bij de hand hebt. 1. Centrifuge 2. Pipetten 3. Puntjes 4. Rekje voor epjes 5. Chemicalien 6. Handschoenen 7. Stift 8. Afvalvat 9. Tissues 10. Vortex/shaker Module: PCR analyse en Gelelectroforese 13 PCR analyse1 Dit type practicum EIST dat je je volledig voorbereid.

14 Electroforese DNAfragmenten zijn negatief geladen en zullen in een electrisch veld van MIN naar PLUS bewegen. De grootte van de fragmenten bepalen de migratiesnelheid. Grote langzaam, kleine snel! Methode: Men maakt een gel van agarose (soort zeewierextract) Hierin worden kuiltjes/welletjes aangebracht. De hele gel gaat in een buffer, waarmee ook de gel gemaakt is. Na 1-2 uur ‘runnen’ zullen de diverse DNA fragmenten zich scheiden op basis van hun grootte. Module: PCR analyse en Gelelectroforese 14 PCR analyse1- deel GELELECTROFORESE

15 Module: PCR analyse en Gelelectroforese 15 PCR analyse1- deel GELELECTROFORESE Het ‘home-made’ electroforese-bakje. De gel ligt verhoogd Links en rechts aansluitingen Ernaast ligt het kammetje dat wordt gebruikt om tijdens het stollen van de gel de kuiltjes (welletjes) te maken. In één welletje past ca 30 uL. Hiernaast de bak aangesloten op 100 volt. Deze gel is bijna halverwege: de kleuren verraden hoevér je bent.

16 Module: PCR analyse en Gelelectroforese 16 PCR analyse1- deel GELELECTROFORESE Deze gel is bijna halverwege: de kleuren verraden hoevér je bent. Agar is niet geschikt. Te grof en de zaak wordt diffuus.

17 Module: PCR analyse en Gelelectroforese 17 PCR analyse1- deel GELELECTROFORESE: het resultaat Let op: de ruler 50bp, de helderheid van bandjes. Welletjes Ruler bandje

18 Verder nog: THUIS: NALEZEN op (noteer ff)www.rshbiologie.nl En dan onder de tweede pagina: module MOLGEN2 Download de leerlinghandleiding en zoek het PCR-practicum op. NU: PRACTICUM met de pipetpunten…. Module: PCR analyse en Gelelectroforese 18 PCR analyse1

19 OEFENEN met PIPETPUNTJES. 1. Neem een kleine en een grote pipetpunt 2. Neem oom één klein epje mee. (mini reageerbuis + dekseltje). 3. Dip deze in de blauwe vloeistof. 4. Door met je vinger op de bovenkant te drukken, kan je minihoeveelheden vloeistof eruit drukken. Da’s voor PCR precies genoeg!! Module: PCR analyse en Gelelectroforese 19 PCR analyse1

20 Module: PCR analyse en Gelelectroforese 20 PCR analyse1

21 Het recept voor PCR.. 1. Je hebt ca 0,5 uL primer A nodig 2. Je hebt ca 0,5 ul primer B nodig 3. Je hebt ca 0,5 uL DNAPOLYMERASE nodig. (doe ik..) 4. Je hebt een beetje DNA uit je aardappel nodig (0,5 uL) 5. Aanvullen met 10 uL PCR-MIX 6. En DNAse vrij water (8 uL). Al deze hoeveelheden zijn samen slechts 20 ul. Module: PCR analyse en Gelelectroforese 21 PCR analyse1


Download ppt "Analysetechnieken a. DNA-isolatie b. DNA-amplificatie: PCR c. Amplicon-detectie: gelectroforese Module: PCR analyse en Gelelectroforese 1 PCR MOLGEN2."

Verwante presentaties


Ads door Google