De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

Module: MOLGEN2: DNA-analyse Inhoud van deze module: 1. Wat is er nu bekend? 2. Wat kan je analyseren 3. Hoe kan je dat analyseren? 4. Analysetechnieken.

Verwante presentaties


Presentatie over: "Module: MOLGEN2: DNA-analyse Inhoud van deze module: 1. Wat is er nu bekend? 2. Wat kan je analyseren 3. Hoe kan je dat analyseren? 4. Analysetechnieken."— Transcript van de presentatie:

1 Module: MOLGEN2: DNA-analyse Inhoud van deze module: 1. Wat is er nu bekend? 2. Wat kan je analyseren 3. Hoe kan je dat analyseren? 4. Analysetechnieken (overzichtje) a. DNA-isolatie b. DNA-amplicficatie: PCR c. Amplicon-detectie: gelectroforese Module: PCR analyse en Gelelectroforese 1 PCR MOLGEN2

2 Bekend: 1. De DNA-volgorde van slechts enkele soorten (Mens, fruitvlieg, kip, koe, worm etc) 2. Van veel soorten is slechts een klein deel bekend 3. Van productiegewassen en dieren is inmiddels het gehele genoom wel bekend. (Financieel belang) 4. Het kennen van de DNA-volgorde wil niet zeggen dat je de genen kent!!! Module: PCR analyse en Gelelectroforese 2 PCR MOLGEN2

3 Tools: 1. Genbanken zoals ncbi: 2. DNA-tools voor het maken van zogenaamde primers (straks meer) 3. Blasts: het opzoeken of stukken DNA-volgorde ergens in het genoom voorkomen. Hiermee wordt verwantschapsanalyse tussen soorten gedaan 4. Merkers en microsatellieten: Hiermee worden vaderschaps-tests uitgevoerd. Voor een individue kenmerkende sequenties. Module: PCR analyse en Gelelectroforese 3 PCR MOLGEN2

4 Fruitvlieg Nbci-database bevat genoom van veel organismen: • Fruitvlieg chromosoom 3L: isplay_name:Sequence,id:STD1,category:Sequence,annots:Sequence,ShowLabel:false][key:gene_model_track,n ame:Genes,display_name:Genes,id:STD3,category:Genes,annots:Unnamed,Options:MergeAll,SNPs:false,CDSProd uctFeats:false,ShowLabelsForAllFeatures:false,HighlightMode:2]&appname=ncbientreznuccore&color=0&label=0 &decor=0&spacing=0&v= : &c=00FF00&gflip=false&select=null • Fruitvlieg vg: Chromosoom 2R: isplay_name:Sequence,id:STD1,category:Sequence,annots:Sequence,ShowLabel:false][key:gene_model_track,n ame:Genes,display_name:Genes,id:STD3,category:Genes,annots:Unnamed,Options:MergeAll,SNPs:false,CDSProd uctFeats:false,ShowLabelsForAllFeatures:false,HighlightMode:2]&appname=ncbientreznuccore&color=0&label=0 &decor=0&spacing=0&v= : &c=333333&gflip=false&select=gi| e3f ca27e44-ffea8d58 Module: PCR analyse en Gelelectroforese 4 PCR MOLGEN2

5 DNA-analyse. Hoe onderzoekt men of een gen er is? 1. Je moet de sequentie van het gen kennen (uit eerder onderzoek) 2. Je moet een idee hebben wáár het zit. 3. Je zoekt in de ncbi-database die plek op. Bijvoorbeeld: Fruitvlieg: we weten dat kenmerk vestigal aanwezig is op chromosoom 2R. 4. We kiezen stukjes flankerende DNA-sequenties om de aanwezigheid van dit gen te vinden: Nodig? De vermeerderings techniek> PCR Polymerase Chain Reaction. Module: PCR analyse en Gelelectroforese 5 PCR MOLGEN2

6 DNA-isolatie Voor dat je een organisme wil checken op de aanwezigheid van een gen, zal je: • Isolatie houdt in: DNA vrij maken uit een hoeveelheid materiaal. • Als de onderzoeker nog meer analyses moet doen, moet het DNA zuiver zijn, en vrij van blokkerende stoffen • Wij beperken ons tot het onderdompelen van een stukje bladmateriaal in een bufferoplossing. Die maakt het celmembraan stuk en bevrijdt het DNA • Bij lastige organismen (schimmels ed) moet je soms dik 30 stappen zetten om het DNA te bevrijden… Lastig,duur en tijdrovend. • Gelukkig heeft de biochemische industrie overal ‘kits’ voor op de markt gebracht die veel werk verlichten. Module: PCR analyse en Gelelectroforese 6 PCR MOLGEN2

7 Analysetechnieken a. DNA-isolatie b. DNA-amplificatie: PCR c. Amplicon-detectie: gelectroforese Module: PCR analyse en Gelelectroforese 7 PCR MOLGEN2

8 PCR Wat is PCR? • Staat voor Polymerase Chain Reaction • Ontwikkeld door de Amerikaan Karry Mullis (1983). Nobelprijs gekregen. Wat doet PCR? • Gedeelte van het (deels) bekende genoom vermeerderen (miljarden kopieen) • Toepassingen: snelle detectie van ziekteverwekkers, genen, afwijkende DNAfragmenten etc. Module: PCR analyse en Gelelectroforese 8 PCR analyse1

9 We zoeken het rode gen:..AGCGCGCGCTTTCTCCTCGATCAGTCATCG....TCGCGCGCGAAAGAGGAGCTAGTCAGTAGC.. We willen een techniek die alleen het rode gen doet verdubbelen en niet ál het DNA:..AGCGCGCGCTTTCTCCTCGATCAGTCATCG..  AGTA CGCT ..TCGCGCGCGAAAGAGGAGCTAGTCAGTAGC.. Leidt tot:..AGCGCGCGCTTTCTCCTCGATCAGTCATCG.. TCGCGCGCGAAAGAGGAGCTAGTCAGTA CGCTTTCTCCTCGATCAGTCATCG..TCGCGCGCGAAAGAGGAGCTAGTCAGTAGC.. Module: PCR analyse en Gelelectroforese 9 PCR analyse1

10 En dat leidt tot:..AGCGCGCGCTTTCTCCTCGATCAGTCATCG.. TCGCGCGCGAAAGAGGAGCTAGTCAGTA CGCTTTCTCCTCGATCAGTCAT TCGCGCGCGAAAGAGGAGCTAGTCAGTA CGCTTTCTCCTCGATCAGTCATCG GCGAAAGAGGAGCTAGTCAGTA CGCTTTCTCCTCGATCAGTCATCG..TCGCGCGCGAAAGAGGAGCTAGTCAGTAGC.. Na 40 stappen heb je ca 2^40 van dit soort fragmenten. Module: PCR analyse en Gelelectroforese 10 PCR analyse1

11 De Techniek. Deze methode verlangt een paar ingredienten: 1. Er is maar heel weinig DNA nodig. 2. Aanwezige primers (stukjes DNA van 20 bp lang). 3. Losse nucleotiden (een mengsel van dNTP’s) 4. DNA-polymerase (Hittebestendige versie van het enzym dat nucleotiden aan het enkele DNA vasthecht) 5. Omgevingsfactoren (MgCl2), Water ed. Module: PCR analyse en Gelelectroforese 11 PCR analyse1

12 Hoe werkt het principe? • Bij hoge temperatuur smelten de DNA strengen en raken uiteen (98 graden C) • Dan hechten zich korte apart vervaardigde stukjes enkelstrengs DNA (zgn primers) (bij een bepaalde temp. • Hierna koppelt DNApol er losse nucleotiden aan, en maakt de nieuwe strengen af. • Deze drie stappen herhaal je 30-40x. • Tenslotte koelt het geheel weer af,en heb je enorme hoeveelheid van gekopieerd fragment DNA. Module: PCR analyse en Gelelectroforese 12 PCR analyse1

13 1a gewone dubbelstrengs DNA 1b DNA Smelt bij 98 graden 1c bij ca 50 graden hechten primers 1d bij 72 graden worden deze aangevuld met losse nucleotiden door enzym Taq-DNApolymerase (Taq -= Thermo aquatic) 2b Opnieuw smelt bij 98 graden Module: PCR analyse en Gelelectroforese 13 PCR analyse1

14 2c bij ca 50 graden hechten primers 2d Polymerase knoopt er opnieuw losse nucleotiden aan en verlengt de streng tot het einde. (Bij 72 graden) 3b Opnieuw smelt bij 98 graden voor ronde 3…. Etc etc etc.. Module: PCR analyse en Gelelectroforese 14 PCR analyse1

15 Wat valt op? • Elke ronde verdubbelt het aantal korte fragmenten. Dus na 40 rondes heb je in principe 2 40 fragmenten. • Het aantal grote strengen blijft gelijk • Het aantal ‘halve’ strengen neemt elke stap lineair toe. • Na 40 ronden is het aantal korte fragmenten dermate talrijk dat zij voor het blote oog kunnen worden aangetoond. (Gel-electroforese). Module: PCR analyse en Gelelectroforese 15 PCR analyse1

16 Wat is de werkwijze in de praktijk? A) We moeten DNA zien te halen uit de cellen van het organisme dat we onderzoeken. (plant) B) Hiervan is maar heel weinig DNA nodig C) We voegen de ingredienten voor replicatie toe: water DNA-nucleotiden primers Taq-DNA-polymerase (enzym) zouten ed. D) Dit mengsel doorloopt een herhaald traject van temperaturen (98 graden, 50 graden, 72 graden). E) Tenslotte is het mengsel verrijkt met korte fragmentjes. (Zó talrijk dat de rest nauwelijks meetelt..) Module: PCR analyse en Gelelectroforese 16 PCR analyse1

17 1. Epje 0.2 ml met verdunningsbuffer 2. Voeg 2 mm 2 blad toe 3. Crush met pipetpunt 4. Centrifugeer 5. Neem supernatant over in schoon epje 6. Voeg toe: • Primers • dNTP’s, Mgcl2 mengsel • DNA polymerase • Water En dan….IN DE PCR! Module: PCR analyse en Gelelectroforese 17 PCR analyse1

18 1. Verwarmd deksel 2. Ruimte voor de epjes (0.2 ml) 96 stuks maximaal 3. Aparte instructie aanwezig. 4. Bedieningspaneel Module: PCR analyse en Gelelectroforese 18 PCR analyse1 PCR: Techne CYCLOGENE 1.Ruimte voor 96 epjes 2.Verwarmd deksel voorkomt verdamping.

19 Zorg dat je alles bij de hand hebt. 1. Centrifuge 2. Pipetten 3. Puntjes 4. Rekje voor epjes 5. Chemicalien 6. Handschoenen 7. Stift 8. Afvalvat 9. Tissues 10. Vortex/shaker Module: PCR analyse en Gelelectroforese 19 PCR analyse1 Dit type practicum EIST dat je je volledig voorbereid.

20 Electroforese • DNAfragmenten zijn negatief geladen en zullen in een electrisch veld van MIN naar PLUS bewegen. • De grootte van de fragmenten bepalen de migratiesnelheid. Grote langzaam, kleine snel! • Methode: Men maakt een gel van agarose (soort zeewierextract) • Hierin worden kuiltjes/welletjes aangebracht. • De hele gel gaat in een buffer, waarmee ook de gel gemaakt is. • Na 1-2 uur ‘runnen’ zullen de diverse DNA fragmenten zich scheiden op basis van hun grootte. Module: PCR analyse en Gelelectroforese 20 PCR analyse1- deel GELELECTROFORESE

21 Module: PCR analyse en Gelelectroforese 21 PCR analyse1- deel GELELECTROFORESE Het ‘home-made’ electroforese-bakje. • De gel ligt verhoogd • Links en rechts aansluitingen • Ernaast ligt het kammetje dat wordt gebruikt om tijdens het stollen van de gel de kuiltjes (welletjes) te maken. • In één welletje past ca 30 uL. • Hiernaast de bak aangesloten op 100 volt. • Deze gel is bijna halverwege: de kleuren verraden hoevér je bent.

22 Module: PCR analyse en Gelelectroforese 22 PCR analyse1- deel GELELECTROFORESE • Deze gel is bijna halverwege: de kleuren verraden hoevér je bent. • Agar is niet geschikt. Te grof en de zaak wordt diffuus.

23 Module: PCR analyse en Gelelectroforese 23 PCR analyse1- deel GELELECTROFORESE: het resultaat Let op: de ruler 50bp, de helderheid van bandjes. Welletjes Ruler bandje

24 Werkwijze in detail. Het hele proces laat zich verdelen in drie etappes. 1. DNA-isolatie uit moedermateriaal. Voor dit practicum zijn dat bladeren van de aardappel Module: PCR analyse en Gelelectroforese 24 PCR analyse1 2. DNA-PCR techniek voor amplicons 3. Gel-electroforese

25 Werkwijze in detail. DNA-ISOLATIE • Het zuiver in handen krijgen van DNA is een lastige klus die veelal ingewikkelde chemicalien en handelingen vergt. Module: PCR analyse en Gelelectroforese 25 PCR analyse1 • Er zijn ‘kits’ op de markt die dat proces a.h.w. met een kookboekrecept kunnen maken. Die werken prima maar zijn erg duur (vanaf euro voor 50 reacties..) • Wij gebruiken de Phire-Plant PCR kit waarmee eenvoudige plantaardige samples kunnen worden behandeld. Nadeel: er komen veel vervuilingen mee en verdere analyse van het DNA kan dus niet.

26 Werkwijze in detail. DNA-ISOLATIE In een klein epje van 0.2 ml wordt 10 uL buffer gedaan. 2. Men snijdt op een objectglaasje met schone scalpel een stukje blad/stengel af ter grootte van 1 x 2 mm. 3. Dit wordt erbij gegooid. 4. Met een plastic pipetpunt wordt het materiaal ‘gecrusht.’. Het ziet nu groen van de chlorophyll minuut centrifuge rpm 6. Overpipetteren van het schone supernatant in een schone ep van 0,2 ml. Module: PCR analyse en Gelelectroforese 26 PCR analyse1 Wat gebeurt er? Het DNA dat aan randen zit van het stukje blad is vrij gekomen en wordt door de centrifuge niet naar beneden gedrukt. De bladresten wel. De buffer lyseert enigszins ook de cellen, zodat er meer DNA kan vrijkomen.

27 Werkwijze in detail. PCR 1 1. Van het supernatant wordt maar 0,5 uL monster genomen. (dat is érg weinig… maar genoeg!) 2. Hierbij worden in volgorde toegevoegd: 3. 0,4 uL primer A uL primer B ul PCR buffer (bevattende de dNTP’s, MgCl2 etc) uL Taq-Polymerase. 7. Aanvullen tot 20 uL vloeistof met water dat geen dNase bevat (aquadest dat even gekookt heeft). Men heeft de concentraties zó gekozen dat de hoeveelheden passenbij de reacties. Elk epje bevat zo steeds 20 uL reactiemengsel. Module: PCR analyse en Gelelectroforese 27 PCR analyse1

28 Werkwijze in detail. PCR 2 Vervolgens: 1. Instellen PCR apparaat op programma Dit impliceert: • 1 e ronde 10 min 98 graden • 2 e ronde 10 sec 98 graden, 10 sec 52 graden, 30 sec 72 graden. • Stap twee nog 39 x herhalen. • 3 e ronde: 5 minuten op 72 graden. Laden epjes. PCRapparaat aan, heated lid ook aan, goeie programma selecteren en GO! Module: PCR analyse en Gelelectroforese 28 PCR analyse1

29 Werkwijze in detail. PCR 3 Vervolgens: 1. Instellen PCR apparaat op programma Dit impliceert: • 1 e ronde 10 min 98 graden • 2 e ronde 10 sec 98 graden, 10 sec 52 graden, 30 sec 72 graden. • Stap twee nog 39 x herhalen. • 3 e ronde: 5 minuten op 72 graden. Laden epjes. PCRapparaat aan, heated lid ook aan, goeie programma selecteren en GO! Module: PCR analyse en Gelelectroforese 29 PCR analyse1

30 Werkwijze in detail. Maken van de gel. 1. Neem 25 ml 10 xTBE-buffer. 2. Voeg 225 ml aquadest toe. (10 verdund). 3. Neem hiervan 80 ml. 4. Voeg 1,6 gram agarosepoeder. 5. Verhit in d magnetron voor 45 sec en zwenk 6. Verhit verder totdat het bijna kookt en de agarose is gesmolten en helder is. 7. Laat afkoelen tot ca 60 graden 8. Pipetteer 6 uL EthidiumBromide (giftig en carcinogeen!) erbij. 9. Giet dit in het bakje nadat je de scheidingswandjes geplaatst hebt. 10. Plaats het 9 holes kammetje bij de min- pool. 11. Cool down…. Min min. Module: PCR analyse en Gelelectroforese 30 PCR analyse1

31 Werkwijze in detail. Laden van de GEL 1. Voeg aan elk PCR-epje 6 ul loading dye Dit maakt het inladen zichtbaar. 2. Haal, als de gel goed gestold is, het kammetje eruit. 3. Vul de gelchamber met TBEbuffer in dezelfde concentratie als waarmee de gel is gemaakt. 4. Vul elke welletje met 20 ul mengsel vanuit de epjes met monster én loadingdye. 5. Sluit de chamber met de deksel 6. Sluit de voeding aan op 50 Volt en zet de zaak aan voor 10 min. 7. Na 10 min over op 100 Volt. 8. Na afloop eerst de spanning eraf. 9. Chamber leeggieten in opvangbak. Kijk uit dat de gel er niet uitvalt. Module: PCR analyse en Gelelectroforese 31 PCR analyse1

32 Werkwijze in detail. Bekijken van de gel met UV. Het EtBr hecht zich aan DNA en is fluoriserend als het met UV wordt beschenen. Kijk NOOIT in de UV lamp Als het goed is, is de DNA ladder 50 bp te zien als een reeks bandjes. 1000, 900, 800, 700, 600, 500, 400, 300, 250, 200,150, 100, 50 basepairs. 1. Maak een digitale foto 2. Zet de lamp snel uit. 3. Verpak de Gel in plastig, label en mik het in de vriezer. Daardoor verlopen de bandjes niet en kan je later de zaak nog na eens bekijken. Module: PCR analyse en Gelelectroforese 32 PCR analyse1

33 Werkwijze in detail. Bekijken van de gel met UV. SOMS gaat het gewoon MIS….. Module: PCR analyse en Gelelectroforese 33 PCR analyse1

34 Werkwijze in detail. Bekijken van de gel met UV. SOMS gaat het gewoon GOED! Module: PCR analyse en Gelelectroforese 34 PCR analyse1

35 Hierna volgt de module: DNALAB1 Solanum Of DNALAB2 DROS Of DNALAB3 CSI In alle gevallen: Lees en bestudeer je handleiding!! En werk aandachtig. Deze spullen zijn kostbaar!! Module: PCR analyse en Gelelectroforese 35 PCR analyse1

36 Verder nog: Sequencing: MIT: college over DNA-technieken: Ry4rRdDbk&list=PLF83B8D8C87426E44 Module: PCR analyse en Gelelectroforese 36 PCR analyse1


Download ppt "Module: MOLGEN2: DNA-analyse Inhoud van deze module: 1. Wat is er nu bekend? 2. Wat kan je analyseren 3. Hoe kan je dat analyseren? 4. Analysetechnieken."

Verwante presentaties


Ads door Google