De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

DNA Erfelijke materiaal. – Twee nucleotiden ketens – Elke keten bestaat uit vele duizenden aan elkaar gekoppelde nucleotiden – Nucleotide bestaat uit:

Verwante presentaties


Presentatie over: "DNA Erfelijke materiaal. – Twee nucleotiden ketens – Elke keten bestaat uit vele duizenden aan elkaar gekoppelde nucleotiden – Nucleotide bestaat uit:"— Transcript van de presentatie:

1 DNA Erfelijke materiaal. – Twee nucleotiden ketens – Elke keten bestaat uit vele duizenden aan elkaar gekoppelde nucleotiden – Nucleotide bestaat uit: Fosfaat groep Desoxyribose Stikstofbase: Adenine (A), Thymine (T), Guanine (G) en Cytosine (C) Stikstofbasen vormen vaste paren met elkaar: A met T en G met C

2

3 Opbouw DNA Desoxyribose is een monosacharide (enkelvoudige suiker). Desoxyribose vormt samen met een fosfaatgroep en één base (Adenine, Thymine, Guanine of Cytosine) een nucleotide (vandaar ook de naam DNA: DesoxyriboNucleic Acid). Nucleotide = Desoxyribose + Fosfaatgroep + Base Verschillende volgorden van deze basen coderen voor verschillende eigenschappen.

4

5 DNA Replicatie 1. Origineel DNA molecuul: dubbele streng 2. Initiatie eiwitten binden aan het DNA molecuul. Hieraan kan Helicase zich gaan hechten.

6 3. Het eiwit Helicase bindt aan initiatie eiwitten en draait de DNA spiraal uit elkaar. Er kan nu met de replicatie begonnen worden. 4. Het eiwit Helicase denatureert het DNA molecuul. Er ontstaan twee losse strengen.

7 5. Het primer molecuul bindt zich op een bepaalde plek aan de DNA streng. De primer is een kort stukje RNA. Hier vandaan begint DNA polymerase met het kopiëren van het DNA.

8 Na de replicatie

9 Transcriptie en translatie van het DNA - DNA wordt gedespiraliseerd -De matrijsstreng wordt gekopieerd -RNA Polymerase bindt zich -RNA nucleotiden uit het cytoplasma worden aan de DNA streng gekoppeld DNARNA DesoxiriboseSuikerRibose AdenineBasenAdenine Cytosine Guanine ThymineUracil Dubbele strengKetenEnkele streng

10 Code Start code: stukje DNA gedespiraliseerd Keten verlenging door RNA polymerase Eind code: RNA polymerase koppelt af en kopie is klaar

11 Eiwit synthese Transcriptie speelt zich af in de kern Translatie speelt zich af in het cytoplasma

12 Transcriptie Hoe wordt de DNA-code overgebracht? Aanmaak van mRNA (Messenger RNA, boodschapper)

13 DNA ATGGTATGAATATATACGAAAACACCCTTAA m-RNA-polymerase TACCATACTTATATATGCTTTTGTGGGAATT Benodigdheden:

14 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT DNA bestaat uit een aaneenschakeling van nucleotiden (Nucleotide = desoxyribose + fosfaat + organische base). Alleen de organische basen zijn afgebeeld.  Waterstofbruggen worden verbroken.

15 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA m-RNA-polymerase schuift over DNA-enkelstreng en maakt primair m-RNA via een polymerisatieproces.

16 ATGGTATGAATATATACGAAAACACCCTTAA AUGGUAUGAAUAUAUACGAAAACACCGUUAA  TACCATACTTATATATGCTTTTGTGGGAATT De m-RNA streng wordt losgeknipt van de DNA-streng

17 ATGGTATGAATATATACGAAAACACCCTTAA AUGGUAUGAAUAUAUACGAAAACACCGUUAA TACCATACTTATATATGCTTTTGTGGGAATT

18 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA DNA messenger-RNA De nucleotidenketens van de DNA-streng komen weer tegen elkaar aan te liggen. Product: m-RNA

19 Messenger-RNA m-RNA bestaat uit aan elkaar geschakelde nucleotiden De stikstofbasen zijn: U: uracil (i.p.v. thymine bij DNA) A: adenine G: guanine C: cytosine AUGGUAUGAAUAUAUACGAAAACACCGUUAA

20 Translatie Vertaling van mRNA tot eiwit. Hoe worden eiwitten gemaakt?

21 AUG GUA CGA AAA CAC CGU UAA m-RNA: Ribosoom: Aminozuren RF RF = Release Factor: 30 S 50 S Codon Aminozuur Benodigdheden:

22 AUG GUA CGA AAA CAC CGU UAA AUG = startcodon UAA = stopcodon Valine Arginine Lysine Histidine Arginine Methionine Een codon (triplet) komt overeen met een bepaald aminozuur of duidt start en stop aan. A P

23 EIWIT Methionine Valine Arginine Lysine Histidine Arginine

24 m-RNA codons  Aminozuur UAA  Stop CGU  Arginine CAC  Histidine AAA  Lysine CGA  Arginine GUA  Valine AUG  Methionine / Start EIWIT Aan elkaar geschakelde aminozuren Valine Lysine Arginine Histidine Arginine

25 Genregulatie 5HAVO

26 Genoom Kern DNA DNA in de mitochondriën (mt-DNA) DNA in de bladgroenkorrels

27 Genregulatie Alle cellen zelfde DNA maar niet zelfde functie – Daarom komt in verschillende typen cellen ander DNA tot uiting Dit gebeurt door regulatorgenen

28 Prokaryoten Stuctuurgenen bevatten informatie voor de vorming van eiwitten Deze genen kunnen coderen voor ‘samenwerkende producten’ en liggen daarom vaak naast elkaar in het DNA  expressie wordt tegelijk beïnvloed

29 Voorbeeld Lactose Geen lactose aanwezig in milieu van bacterie: – Een repressor (onderdrukker) zit gebonden aan de plaats in het DNA vlak voor het gen dat de code bevat voor het enzym dat lactose afbreekt

30 Voorbeeld Lactose Wel lactose aanwezig in milieu van bacterie: – Lactose bindt aan de repressor waardoor deze niet meer kan binden aan de plek vlak voor het stukje DNA dat codeert voor het enzym dat lactose afbreekt. Gevolg: enzym wordt gevormd

31 Voorbeeld Tryptofaan Wanneer er geen aminozuren in de voeding van bacteriën aanwezig is kunnen ze zelf alle aminozuren aanmaken m.b.v. bepaalde genen. – Wanneer zal repressor actief en inactief zijn?

32

33 Eukaryoten Embryonale stamcellen worden beïnvloed in hun ontwikkeling door de plek waar ze zich bevinden – Regulatorgenen aan of uit in cel bepalen aanmaak eiwitten van die cel – Eiwitten van deze cellen beïnvloeden ontwikkeling naburige cellen – In deze cellen regulatorgenen aan of uit gezet

34

35 Ontwikkeling organisme Tijdens de ontwikkeling van een organisme kunnen in stamcellen andere genen tot expressie worden gebracht Hierdoor verschillende cellen waaruit nieuwe weefsels en organen kunnen ontwikkelen

36 Fruitvlieg In het embryonale stadium: de genen voor de vleugelvorming zijn uitgeschakeld In het volwassen stadium ingeschakeld

37 Hoe kan dit? In embryonale stadium worden eiwitten gevormd Deze eiwitten hebben zetten bepaalde genen “aan” of “uit” waardoor deze genen juist wel of niet tot uiting komen in het volwassen stadium

38 Genregulatie volwassen organisme De aanwezigheid of afwezigheid van bepaalde stoffen bepalen of repressors actief of inactief worden. Wanneer repressors binden aan stukjes DNA blokkeren zij de vorming van mRNA en dus blokkeren zij de genexpressie

39 Genregulatie volwassen organisme DNA kan ook ‘inactief’ worden gemaakt door een bepaalde chemische stof te binden aan de stikstofbasen van het DNA Dit zijn methylgroepen DNA wordt compact gemaakt Bij DNA-replicatie en celdeling wordt dit doorgegeven

40 DNA Methylering

41 Epigenetica Bepaalde invloeden van buitenaf kunnen invloed hebben op genexpressie – Stress – Voeding – Drugs Genen worden aan of uitgezet door DNA losser of steviger te binden om eiwitten of door DNA methylering

42 Mutaties 5HAVO

43 Gennoommutatie Het aantal chromosomen in een cel is veranderd. Dit kan gebeurd zijn tijdens de meiose doordat er chromosomen bij elkaar blijven en samen in 1 cel terecht komen. Hierdoor geslachtscellen met 1 chromosoom teveel en 1 chromosoom te weinig

44 Genoommutatie

45 Puntmutatie Door verandering in stikstofbase verandert de code voor een bepaald eiwit. Hierdoor wordt niet meer het juiste eiwit gemaakt

46 Oorzaken mutaties Mutagene stoffen: – Radioactieve straling – Röntgenstraling – UV-straling – Chemische stoffen (asbest, sigarettenrook) – Virussen

47 DNA reparatie Enzymen checken of DNA goed gekopieerd is en vervangen ‘foute’ stikstofbasen voor ‘juiste’ Toch kan DNA schade optreden doordat de enzymen ‘te laat’ zijn en het DNA zonder controle verdeeld wordt over de dochtercellen Cellen automatisch dood door tot uiting komen van tumorsupressorgen Deze genen zorgen voor eiwitten die de celdood aansturen

48 Effecten mutaties In een niet-coderend deel van het DNA In een recessief gen Bijdrage aan overlevingskans soort In geslachtscellen In bevruchte eicel In cel van embryo Kanker

49 Mutatie in tumorsupressorgen (zorgt voor automatische celdood) Mutatie in proto-oncogen (stimuleren celgroei en celdifferentiatie)  verandert in oncogen Reageren niet meer op stoffen die celdeling remmen Primaire en secundaire tumor

50 DNA toepassingen Oplossen van politie zaken Organismen “creëren” met gunstige genen (genetische modificatie) – Recombinant DNA techniek

51 cDNA Bepaald gen uit organisme verkrijgen: – RNA isoleren van het gen dat interessant is – Vanuit het RNA DNA maken (complementair DNA of copie DNA ook wel cDNA) – Dit cDNA kan in de plasmide van een bacterie gebracht worden


Download ppt "DNA Erfelijke materiaal. – Twee nucleotiden ketens – Elke keten bestaat uit vele duizenden aan elkaar gekoppelde nucleotiden – Nucleotide bestaat uit:"

Verwante presentaties


Ads door Google