De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

Medicijnontwikkeling Problemen: Ca. 1 procent van de potentiële medicijnen haalt de eindstreep: succesvolle toepassing in de mens Gehele proces duurt.

Verwante presentaties


Presentatie over: "Medicijnontwikkeling Problemen: Ca. 1 procent van de potentiële medicijnen haalt de eindstreep: succesvolle toepassing in de mens Gehele proces duurt."— Transcript van de presentatie:

1

2 Medicijnontwikkeling Problemen: Ca. 1 procent van de potentiële medicijnen haalt de eindstreep: succesvolle toepassing in de mens Gehele proces duurt ca. 14 jaar Pharmacophylogenomics – Explaining interspecies differences in drug discovery 2 30% 65% 55% 55% 70% 50% 65% 95% DevelopmentResearch Proof of Concept (PoC) 2y 4y 1½ y 1y 2½ y 2½ y Target disco very Lead Identif ication Lead optimi zation Pre- clini cal Phase 0 Phase IIa Phase III Phase IV Phase I Phase IIb

3 Proefdieren Groot deel van het probleem ligt in de koppeling van proefdier (meestal muis of rat) naar mens; situatie is niet altijd gelijk Pharmacophylogenomics – Explaining interspecies differences in drug discovery 3 Slechts één derde van het onderzoek in proefdieren kan succesvol worden ‘vertaald’ naar de mens* Vóór dierproeven al veel tijd en geld besteed * Hackam et al. (2006)

4 Voorbeeld (1): H.I.V. Veroorzaker van AIDS (immuundeficiëntie) H.I.V.: Human Immunodeficiency Virus Alleen te testen in mensapen… moeilijk toestemming, en ook hier nog verschillen  probleem voor medicijn- onderzoek Pharmacophylogenomics – Explaining interspecies differences in drug discovery 4

5 Voorbeeld (2): Reuma Reumatoïde artritis Ontsteking van het synovium in gewrichten Nog steeds geen echt medicijn voor, alleen remmers Grote verschillen tussen mens en proefdier (meestal muis en rat, kunstmatig opgewekt)  probleem voor medicijnonderzoek Pharmacophylogenomics – Explaining interspecies differences in drug discovery 5

6 Voorbeeld (3): Astma Chronische ontsteking van de luchtwegen Muizen en ratten niet zo geschikt als proefdier Cavia staat dichter bij mens, en pathofysiologie van astma komt beter overeen Echter nog steeds verschillen met het menselijke astma  probleem voor medicijn- onderzoek Pharmacophylogenomics – Explaining interspecies differences in drug discovery 6

7 Wat te doen? Vergelijking maken tussen de situatie in het proefdier en de situatie in de mens, om te kijken waar de verschillen zitten Die verschillen zitten hem uiteindelijk in de kleinste functionele delen van de levende cel: de eiwitten, hun interacties met elkaar en hun interacties met andere delen van de cel Pharmacophylogenomics – Explaining interspecies differences in drug discovery 7

8 Eiwit (proteïne) Pharmacophylogenomics – Explaining interspecies differences in drug discovery 8 - Gemiddeld slechts nanometers (=miljoenste millimeters!) groot - Vervult belangrijke functies in de cel - Bestaat uit ketens van aminozuren -Deze 20 verschillende typen aminozuren kunnen worden vereenvoudigd tot letters: …MNGTEGPNFYVPFSNVTGVVRSPFEQPQYYLAEPWQF SMLAAYMFLLIVLGFPINFLTLYVTVQHKKLRTPLNY ILLNLAVADLFMVFGGFTTTLYTSLHGYFVFGPTGCN…

9 DNA  RNA  Eiwit DNA (gen) transcriptie RNA translatie Eiwit Pharmacophylogenomics – Explaining interspecies differences in drug discovery 9 …CGTAGCTAGCTGATCGTAGCTAGCTGACTGATCTAGC CGATCGTAGCTAGCTAGCGATCGTGATCTAGCGCTAG TGACTGATCGTACTAGCTACTGACTCATCGAGGCATA… …MNGTEGPNFYVPFSNVTGVVRSPFEQPQYYLAEPWQF SMLAAYMFLLIVLGFPINFLTLYVTVQHKKLRTPLNY ILLNLAVADLFMVFGGFTTTLYTSLHGYFVFGPTGCN…

10 Pharmacophylogenomics – Explaining interspecies differences in drug discovery 10 Hoe de organismen te koppelen?

11 Orthologie Koppeling van eiwit(ten) in proefdier naar eiwit(ten) in mens Pharmacophylogenomics – Explaining interspecies differences in drug discovery 11 ≈≈≈≈ Orthologe eiwitten: eiwitten met gelijke evolutionaire oorsprong, die een vergelijkbare functie hebben, maar in verschillende soorten. Het ontbreken van, of dubbel voorkomen van, zo’n ortholoog kan een aanwijzing geven voor het (niet) werken van een medicijn.

12 Orthologie bepaling Door eiwitvolgordes (‘aminozuur-sequenties’) te vergelijken met computer-algoritmen Kan op verschillende manieren (sequentie- vergelijking, phylogenetische bomen) en met verschillende (statistische) toetsen Pharmacophylogenomics – Explaining interspecies differences in drug discovery 12

13 Databanken Alle gegevens over orthologie bij elkaar: heel veel gegevens! (honderden soorten, elk tienduizenden eiwitten, elk honderden/ duizenden aminozuren -> miljarden bytes) Pharmacophylogenomics – Explaining interspecies differences in drug discovery 13 Gegevens moeten worden opgeslagen in databanken, op computer-servers, om informatie gemakkelijk terug te kunnen vinden

14 Pharmacophylogenomics – Explaining interspecies differences in drug discovery 14

15 Dit proefschrift Beschrijft en vergelijkt verschillende computer-methoden voor: –sequentie vergelijking (H3) –orthologie bepaling (H2) Beschrijft een databank van orthologe genen over een reeks van enkele tientallen model organismen (waaronder muis en rat) plus mens (H4) Pharmacophylogenomics – Explaining interspecies differences in drug discovery 15

16 Dit proefschrift Toont enkele toepassingen van orthologie: –in de immunologie (H5) –in de evolutie van genen (H6) –in de transcriptomics (H7) Plaatst dit alles in een kader van medicijn- ontwikkeling: –inleiding (H1) –discussie (H8) Pharmacophylogenomics – Explaining interspecies differences in drug discovery 16

17 Titel: ‘Pharmacophylogenomics’ ‘Pharmaco’  we kijken naar medicijnen ‘Phylo’ (Gr. ras, klasse)  we kijken naar de evolutie van eiwitten ‘Genomics’  we kijken naar grote groepen van genen (en eiwitten) in meerdere organismen Pharmacophylogenomics – Explaining interspecies differences in drug discovery 17

18


Download ppt "Medicijnontwikkeling Problemen: Ca. 1 procent van de potentiële medicijnen haalt de eindstreep: succesvolle toepassing in de mens Gehele proces duurt."

Verwante presentaties


Ads door Google