De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

DNA, RNA en Eiwitsynthese Moleculaire genetica Hoofdstuk 11.

Verwante presentaties


Presentatie over: "DNA, RNA en Eiwitsynthese Moleculaire genetica Hoofdstuk 11."— Transcript van de presentatie:

1 DNA, RNA en Eiwitsynthese Moleculaire genetica Hoofdstuk 11

2 Bouw van het DNA

3 Een nucleotide is opgebouwd uit: 1. Fosfaatgroep 2. Suiker (desoxyribose) 3. Organische N – base Adenine (A) Thymine (T) Cytosine (C) Guanine (G)

4 DNA Nucleotiden zijn opgebouwd uit 3 onderdelen

5

6 DNA Nucleotiden zijn opgebouwd uit 3 onderdelenuit

7 Paarvorming.

8 DNA-replicatie door DNA-polymerase

9 Bouw van het DNA Het DNA is opgebouwd uit twee ketens van nucleotiden

10 Bouw van het DNA Chemische structuur

11 Bouw van het DNA De nucleotides van beide strengen zijn verbonden d.m.v. H- bruggen Tussen A en T een dubbele H – brug Tussen C en G een drievoudige H - brug

12 Basen sequenties en codering Adenine & Thymine (A tegenover T) Cytosine & Guanine (C tegenover G) Dus: Streng 1: GCCATAACGA Streng 2: CGGTATTGCT Dit noemen we de erfelijke code.

13 Bouw van het DNA De beide ketens (strengen) vormen ruimtelijk de zgn. Dubbele Helix

14 Bouw van het DNA De ontdekking van de double helix werd gedaan in 1953 door Watson en Crick

15 Bouw van een chromosoom Histonen, de eiwit bolletjes waar de dubbele DNA helix omheen is gewikkeld. Gen, is een stukje DNA

16 OEFENING: Omschrijf de volgende begrippen: Nucleotide. DNA. Gen. Chromosoom. Erfelijke code. Maak opdracht 1 t/m 5

17 Replicatie Verdubbeling van het DNA. Stap 1: DNA ketens worden van elkaar losgemaakt. Stap 2: Speciale enzymen voorkomen dat de ketens weer aan elkaar gaan zitten.

18 Replicatie Iedere DNA streng heeft een 3’ en een 5’ einde. Nieuwe nucleotide komen altijd aan het 3”einde, De leading streng kan zich zo continue verlengen. Replicatie

19 2 DNA moleculen liggen niet los van elkaar. Het centromeer is niet verdubbeld. Centromeer is de bindingsplaats voor twee chromatiden. DNA

20 OEFENING: Animatie: replicatie

21 Transcriptie. RNA is nodig voor transcriptie. Verschil DNA en RNA RNA polymerase, breekt de H-bruggen m-RNA (messenger- RNA)is nu ontstaan. DNARNA 2 nucleotide ketens1 nucleotide keten DesoxyriboseRibose ThymineUracil Bioplek animatie: m-RNA

22 DNA ATGGTATGAATATATACGAAAACACCCTTAA RNA-polymerase TACCATACTTATATATGCTTTTGTGGGAATT Benodigdheden:

23 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT DNA bestaat uit een aaneenschakeling van nucleotiden (Nucleotide = desoxyribose + fosfaat + organische base). Alleen de organische basen zijn afgebeeld.  Waterstofbruggen worden verbroken.3 waterstofbruggen tussen Guanine en Cytosine 2 waterstofbruggen tussen Adenine en Thymine

24 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA m-RNA RNA-polymerase schuift over DNA-enkelstreng en maakt m-RNA via een polymerisatieproces.

25 De nucleotide volgorde van het m-RNA bepaald welke aminozuren er nodig zijn voor het maken van het eiwit. De nucleotide volgorde is een code. 3 nucleotiden is een triplet of codon. Einde van de code is het stopcodon Transcriptie Zie bladzijde 230

26 Detail van de transcriptie In het mRNA worden de coderende eenheden van drie nucleotiden een CODON genoemd Transcriptie

27 Het mRNA gaat via het endoplasmatisch reticulum naar het ribosoom Het ribosoom “vouwt” het DNA uit in het cytoplasma Transcriptie

28 Voor de eiwitsynthese zijn niet alleen ribosomen en m-RNA nodig maar ook: t-RNA (transport RNA). Transcriptie

29 t-RNA Aan het uiteinde bevindt zich een specifieke bindingsplaats voor een aminozuur Het anticodon bepaalt welk aminozuur er gebonden wordt

30 OEFENING: Bioplek animatie: transcriptie

31 Translatie De anticodons van het tRNA binden zich aan de codons van het mRNA. De Aminozuren worden in de correcte volgorde gezet De aminozuren koppelen zich aan elkaar: er ontstaat een eiwit TRANSLATIE

32 Translatie Weergave van de translatie

33 OEFENING: Bioplek animatie: genetische code Opdracht 6 t/m 20

34 OEFENING: Maak een lijstje waar je de volgende begrippen uitlegt: Replicatie Transcriptie Translatie Maak een lijstje waar je de volgende begrippen uitlegt: RNA m-RNA t-RNA Filmpje: samenvatting moleculaire genetica samenvatting moleculaire genetica.docx


Download ppt "DNA, RNA en Eiwitsynthese Moleculaire genetica Hoofdstuk 11."

Verwante presentaties


Ads door Google