De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

DEEL 1 Genetica Moleculaire mechanismen van genexpressie Thema 2.2.

Verwante presentaties


Presentatie over: "DEEL 1 Genetica Moleculaire mechanismen van genexpressie Thema 2.2."— Transcript van de presentatie:

1 DEEL 1 Genetica Moleculaire mechanismen van genexpressie Thema 2.2

2 Identificatie van DNA als drager van de genetische info ste helft 20 ste eeuw: onduidelijk of DNA of proteïnen de dragers zijn van de erfelijke eigenschappen Experimenten van Griffith en Avery met pneumokokken bewijzen dat DNA de drager is van genetische informatie

3 Genexpressie en fenotype 2 2 Gen  Polypeptide  Proteïne   Genexpressie: erfelijke informatie in de basensequentie van het DNA wordt omgezet in een fenotypisch kenmerk

4 Centrale hypothese v. moleculaire biologie 3 3

5 Chemische samenstelling van RNA Nucleïnezuur, opgebouwd uit nucleotiden  Ribose (ipv. desoxyribose)  Fosfaatgroep  Organische stikstofbase Cytosine Guanine Adenine Uracil  ipv. thymine bij DNA

6 Ruimtelijke structuur van RNA Enkelstrengig Oriëntatie 5’  3’ Kan ruimtelijk opgevouwen zijn door basenparing

7 Structuur van proteïnen Macromoleculen opgebouwd uit aminozuren Alle aminozuren hebben een centraal C-atoom met daaraan gebonden:  een aminogroep: -NH 2  een H-atoom: -H  een carboxylgroep: -COOH  een restgroep: -R

8

9

10 condensatiereactie Aminozuren worden verbonden door een peptidebinding tussen de carboxylgroep van het ene aminozuur en de aminogroep van het andere

11 Primaire eiwitstructuur De aminozuurvolgorde van het eiwit

12 Secundaire eiwitstructuur Ontstaat als de aminozuren zich ordenen in een alfa-helix of een beta-sheet Waterstofbruggen!

13 Tertiaire eiwitstructuur Ontstaat als alfa-helices of een beta-sheets zich vouwen tot een complexe 3-dimensionele structuur. Waterstofbruggen en disulfidebruggen

14 Quarternaire eiwitstructuur Ontstaat als 2 of meer peptiden samen een eiwit vormen. Vb: hemoglobine

15 Proteïnesynthese als resultaat van genexpressie 4 4

16 In de kern bevinden zich DNA-moleculen die de genetische codes bevatten voor de erfelijke kenmerken. Bij de mens vinden we er 46 DNA-moleculen per cel. KERN DNA CYTOPLASMA

17 DNA CYTOPLASMAKERN In de kern bevinden zich DNA-moleculen, waarvan er hier één is afgebeeld. Het is een dubbelstreng (helix). De DNA-helix ontplooit zich op de plaats waar de genetische codes liggen voor de aanmaak van een bepaald eiwit. Messenger-RNA (boodschapper-RNZ voor een bepaald eiwit) wordt gemaakt, overeenkomstig met de DNA-codes. m-RNA

18 DNA CYTOPLASMAKERN m-RNA wordt losgekopppeld van DNA en de DNA-helix sluit zich weer. m-RNA

19 m-RNA verlaat de celkern via de kernporiën.

20 m-RNA schuift in ribosomen binnen. Ruw endoplasmatisch reticulum Ribosoom m-RNA KERN

21 De eiwitten kunnen terecht komen in het endoplasmatisch reticulum. Ruw endoplasmatisch reticulum Ribosoom m-RNA Eiwit KERN

22 De eiwitten kunnen de cel verlaten. Ruw endoplasmatisch reticulum Ribosoom m-RNA Eiwit KERN

23

24 4.1 Basensequentie in DNA (gen) Basensequentie in mRNA transcriptie

25 DNA Benodigdheden ATGGTATGAATATATACGAAAACACCCTTAA  Knipenzym X m-RNA-polymerase TACCATACTTATATATGCTTTTGTGGGAATT  Knipenzym Y

26 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT DNA bestaat uit een aaneenschakeling van nucleotiden (Nucleotide = desoxyribose + fosfaat + organische base). Alleen de organische basen zijn afgebeeld.  Waterstofbruggen worden verbroken.3 waterstofbruggen tussen Guanine en Cytosine 2 waterstofbruggen tussen Adenine en Thymine

27 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT precursor messenger-RNA m-RNA-polymerase schuift over DNA-enkelstreng en maakt precursor m-RNA via een polymerisatieproces. AUGGUAUGAAUAUAUACGAAAACACCGUUAA

28 ATGGTATGAATATATACGAAAACACCCTTAA AUGGUAUGAAUAUAUACGAAAACACCGUUAA  TACCATACTTATATATGCTTTTGTGGGAATT precursor messenger-RNA

29 ATGGTATGAATATATACGAAAACACCCTTAA AUGGUAUGAAUAUAUACGAAAACACCGUUAA TACCATACTTATATATGCTTTTGTGGGAATT

30 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA precursor messenger-RNA

31 ATGGTATGAATATATACGAAAACACCCTTAA TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA DNA precursor messenger-RNA

32 AUGGUAUGAAUAUAUACGAAAACACCGUUAA precursor messenger-RNA  Splicing Bepaalde stukken zullen uit dit RNA geknipt worden door bepaalde enzymen. Dit proces heet splicing. Alzo wordt precursor messenger-RNA het uiteindelijke messenger- RNA (mRNA).

33 UGAA precursor messenger-RNA AUGGUA Intron ExonExon = Expressed region UAUAUACGAAAACACCGUUAA

34 AUGGUACGAAAACACCGUUAA messenger-RNA m-RNA bestaat uit aan elkaar geschakelde nucleotiden (nucleotide = ribose + fosfaat + organische base). De organische basen zijn: U: uracil (i.p.v. thymine bij DNA) A: adenine G: guanine C: cytosine

35 Precursor-RNA kan vele introns bevatten!

36 Basensequentie in mRNA Aminozuursequentie in polypeptide translatie

37 AUG GUA CGA AAA CAC CGU UAA m-RNA ribosoom t-RNA Benodigdheden RF RF = Release Factor 30 S 50 S Anti-codon Codon Aminozuur

38 mRNA-codons >> aminozuur

39 Andere voorstelling: aflezen van binnen naar buiten. 5’  3’

40 Transfer-RNA (tRNA)  Elk tRNA bezit een anticodon (triplet) dat complementair is met een codon (triplet) van het mRNA  Elk tRNA heeft een bindplaats voor een aminozuur (3’)

41 AUG GUA CGA AAA CAC CGU UAA AUG = startcodon UAA = stopcodon Valine Arginine Lysine Histidine Arginine Methionine Een codon (triplet) komt overeen met een bepaald aminozuur of duidt start en stop aan.

42 AUG GUA CGA AAA CAC CGU UAA AUG = startcodon Het m-RNA zal doorheen het ribosoom schuiven om de codons (3 basen) af te lezen en te vertalen in de overeenstemmende aminozuren, die aangebracht worden door t-RNA. Deze aminozuren worden aan elkaar gekoppeld tot een eiwit. Met Val Translatie: in 5’ 3’ richting van mRNA

43 AUG GUA CGA AAA CAC CGU UAA MetVal

44 AUG GUA CGA AAA CAC CGU UAA Val Met

45 AUG GUA CGA AAA CAC CGU UAA Met Val Arg

46 AUG GUA CGA AAA CAC CGU UAA Met Val Arg

47 AUG GUA CGA AAA CAC CGU UAA Met Val Lys Arg

48 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys

49 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His

50 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His

51 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His Arg

52 AUG GUA CGA AAA CAC CGU UAA Met Val Arg Lys His Arg

53 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg

54 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg

55 AUG GUA CGA AAA CAC CGU UAA RF Met Val Arg Lys His Arg

56 AUG GUA CGA AAA CAC CGU UAA RF EIWIT t-RNA-molecylen worden weer voorzien van hun juiste aminozuren Met ValArg Lys His Arg

57 EIWIT Methionine Valine Arginine Lysine Histidine Arginine Methionine kan afgeknipt worden.

58 m-RNA codons  Aminozuur UAA  Stop CGU  Arginine CAC  Histidine AAA  Lysine CGA  Arginine GUA  Valine AUG  Methionine / Start EIWIT Aan elkaar geschakelde aminozuren Arginine Histidine Valine Lysine Arginine

59 Voorbeeld in het handboek (p. 68 …)  Synthese van de proteïne oxytocine (hormoon) Contractie baarmoeder tijdens de bevalling Contractie baarmoeder na bevalling Contractie spiertjes rond de melkklieren  Aanmaak in de hypothalamus

60 transcriptie

61 5’ GAGGGGAAAUCUGAUGUGCUACAUACAGAACUGUCCCCUCGGCUAG 3’ Volledige mRNA voor oxytocine De eerste nucleotiden v ÓÓ r het startcodon AUG worden niet vertaald in aminozuren. De translatie begint dus vanaf het startcodon AUG (vorming van het startcomplex). translatie

62 Binding van aminozuren aan specifieke tRNA’s door enzymen.

63 5’ AUG UGC UAC AUA CAG AAC UGU CCC CUC GGC UAG 3’ Vorming van het startcomplex

64 5’ AUG UGC UAC AUA CAG AAC UGU CCC CUC GGC UAG 3’ Met Cys Tyr Ile Gln Asn Cys Pro Leu Gly Stop

65

66 Einde van de translatie: stopcodon (UAG)  release factor (RF) Methionine wordt afgeknipt + transport naar golgicomplex

67 Parelsnoer van ribosomen op één mRNA-streng Vorming van polysomen

68 4.4Overzicht verloop proteïnesynthese de basensequentie van het DNA-fragment (gen) voor oxytocine de basensequentie van een mRNA een aminozuursequentie in een polypeptide de functionele proteïne oxytocine Voorbeeld : vorming van oxytocine transcriptie in de celkern translatie in het cytosol opvouwing van de polypeptide

69

70

71 https://www.youtube.com/watch?v=7D6EqlL5VsA https://www.youtube.com/watch?v=5wMqHOf692E https://www.youtube.com/watch?v=nHM4UUVHPQM&spfreload=1www.youtube.com/watch?v=nHM4UUVHPQM&spfreload=1 https://www.youtube.com/watch?v=M568QP1K3sM Animaties eiwitsynthese

72 Eén gen, meerdere polypeptiden 5 5 O.b.v. één gen kunnen verschillende proteïnen gevormd worden! Hiervoor bestaan verschillende mechanismen: 5.1 Alternatieve splicing van pre-mRNA Letters: exons Cijfers: introns

73

74 5.2 Meerdere startplaatsen voor transcriptie

75 5.3 Modificatie van proteïnen na translatie Na de translatie kunnen :  Polypeptideketens doorgeknipt worden  Sacharideketens aangehecht worden  Fosfaatgroepen aangehecht worden Eén gen  verschillende eiwitproducten Voorbeeld: aanmaak van insuline Door afsplitsing van de C-peptide wordt actieve insuline gevormd. C-peptide krijgt een aparte functie (doorbloeding stimuleren)

76 Definitie van een gen bijsturen 6 6 Een gen is een eenheid van overerving en heeft een chromosomale locus. Het is een DNA-fragment dat de code bevat voor de aanmaak van één of meer polypeptiden of voor de aanmaak van een RNA-molecule Human Genome Project

77 Regulatie van genexpressie Noodzaak van regulatie van genexpressie Elke cel van een organisme bevat het volledige DNA Niet elk gen komt in elke cel tot expressie bv. genen voor insulineproductie komen enkel in bepaalde pancreascellen tot expressie Sommige genen komen slechts tijdelijk tot expressie in een bepaalde cel bv. genen voor melkeiwitten in borstkliercellen De intensiteit van de genexpressie kan variëren

78 7.2 Opbouw van een expressie-eenheid Gen: onderdeel van een combinatie van verschillende DNA- fragmenten die samen een expressie-eenheid vormen. Transcriptie-eenheid (=structuurgenen) Basensequentie van 1 of meerdere naast elkaar gelegen genen Promotor Kort stuk DNA dat dient als startsignaal voor transcriptie Regulatorgenen (= regelgenen) Coderen voor proteïnen die transcriptie van structuurgenen beïnvloeden

79 7.3 Regulatie van genexpressie bij prokaryoten Prokaryoten moeten zich zeer snel kunnen aanpassen aan wijzigingen in hun milieu  genregulatie door repressie en inductie Operon Bij prokaryoten liggen, functioneel bij elkaar horende structuurgenen, vlak bij elkaar, onder controle van 1 gemeenschappelijke promotor.  Volledige expressie-eenheid = operon

80 7.3.2 Genregulatie door repressie en inductie Voorbeeld: regulatie lactose-metabolisme bij E. coli Geen lactose aanwezig: lac-operon met repressor Wel lactose aanwezig: lac-operon met inductor

81 7.4 Regulatie van genexpressie bij eukaryoten Genenbatterijmodel voor transcriptieregulatie De transcriptie wordt gereguleerd door een integratorgen dat zelf onder controle staat van een sensor die gevoelig is voor moleculaire signalen van oa. hormonen Integratorgen ≈ regulatorgen bij prokaryoten Receptorgen ≈ operator bij prokaryoten

82 De epigenetische code Dubbele helix onder de duim?? Verborgen erfelijke code laat genen zwijgen De volgorde van de vier bouwstenen van de dubbele helix is niet het enige wat iemands erfelijke eigenschappen bepaalt. Zelfs wat de moeder eet tijdens de zwangerschap kan invloed hebben! DNA-code is de blauwdruk van het leven maar..

83 Allerlei epigenetische ‘labels’ fungeren als een soort volumeknop waarmee de activiteit van de genen kan gereguleerd worden

84  organisatie chromatine euchromatine heterochromatine DNA sterk gecondenseerd Nucleosomen verder uit elkaar Genexpressie mogelijk

85

86  chemische labels aan de histonen Chemische aanhangsels op de histonen kunnen de expressie van genen … onderdrukken bv. methyl (CH 3 ) bevorderen bv. acetyl (COCH 3 )  

87

88  metylmerkers op DNA Metylgroepen hechten zich op een nucleotide C die gevolgd wordt door een nucleotide G ACTACGAGTAGGATTTTCGATCGTCCCA H H H-C-H Gen gedeactiveerd H H-C-H

89

90  transposons ‘jumping genes’ Klonen zichzelf en sturen kopieën over het ganse genoom. (oa. afkomstig van virussen) kunnen in genen terechtkomen en mutaties veroorzaken of genexpressie onderdrukken of stimuleren DNA beschermt zich hiertegen door methylering

91

92  imprinting Imprinting beïnvloed genen in de gameten waardoor die genen inactief worden. Bij maternale imprinting wordt het gen dat van moeder is geërfd inactief gemaakt en komt dat van vader juist tot uitdrukking. Imprinting van het gen van vaders kant (paternale imprinting) zorgt ervoor dat het gen vaders kant inactief wordt en dat van moeder tot uitdrukking komt.

93 hypotetisch voorbeeld van imprinting Links: maternale imprinting voor het gen (genen) voor huidskleur; het ‘blank-gen’ van de moeder komt niet tot expressie bij de nakomelingen Rechts: paternale imprinting

94 lijger

95 Lijger ♀ : tijger ♂ : leeuw Tot 500 kg!

96 teeuw ♂ tijger x ♀ leeuw

97  RNA-interferentie (RNAi) Genonderdrukking door dubbelstrengs RNA. Micro-RNA (miRNA) zijn kleine ‘antisense’- sequenties in het cytoplasma die zich kunnen binden met het mRNA (‘sense’-sequentie) Hierdoor ontstaat dubbelstrengs-RNA (dsRNA) Dit dsRNA bindt zich dan aan een eiwitcomplex Dicer (=‘snijmachine’) dat het in kleinere stukken hakt  er is geen translatie mogelijk Regelt oa. apoptose en celdifferentiatie

98 Schema RNA-interferentie

99

100


Download ppt "DEEL 1 Genetica Moleculaire mechanismen van genexpressie Thema 2.2."

Verwante presentaties


Ads door Google