De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

Moleculaire mechanismen van genexpressie

Verwante presentaties


Presentatie over: "Moleculaire mechanismen van genexpressie"— Transcript van de presentatie:

1 Moleculaire mechanismen van genexpressie
Thema 2.2 Moleculaire mechanismen van genexpressie DEEL 1 Genetica

2 1 Identificatie van DNA als drager van de genetische info
1ste helft 20ste eeuw: onduidelijk of DNA of proteïnen de dragers zijn van de erfelijke eigenschappen Experimenten van Griffith en Avery met pneumokokken bewijzen dat DNA de drager is van genetische informatie

3 2 Gen  Polypeptide Proteïne Genexpressie en fenotype
Genexpressie: erfelijke informatie in de basensequentie van het DNA wordt omgezet in een fenotypisch kenmerk Gen Polypeptide Proteïne

4 Centrale hypothese v. moleculaire biologie
3 Eiwitsynthese DNA >>>>>>> m-RNA>>>>>>> eiwit Transcriptie Translatie

5 Chemische samenstelling van RNA
Nucleïnezuur, opgebouwd uit nucleotiden Ribose (ipv. desoxyribose) Fosfaatgroep Organische stikstofbase Cytosine Guanine Adenine Uracil  ipv. thymine bij DNA

6 Ruimtelijke structuur van RNA
Enkelstrengig Oriëntatie 5’  3’ Kan ruimtelijk opgevouwen zijn door basenparing

7 Structuur van proteïnen
Macromoleculen opgebouwd uit aminozuren Alle aminozuren hebben een centraal C-atoom met daaraan gebonden: een aminogroep: -NH2 een H-atoom: -H een carboxylgroep: -COOH een restgroep: -R

8

9

10 Aminozuren worden verbonden door een peptidebinding tussen de carboxylgroep van het ene aminozuur en de aminogroep van het andere condensatiereactie

11 Primaire eiwitstructuur
De aminozuurvolgorde van het eiwit

12 Secundaire eiwitstructuur
Ontstaat als de aminozuren zich ordenen in een alfa-helix of een beta-sheet Waterstofbruggen!

13 Tertiaire eiwitstructuur
Ontstaat als alfa-helices of een beta-sheets zich vouwen tot een complexe 3-dimensionele structuur. Waterstofbruggen en disulfidebruggen

14 Quarternaire eiwitstructuur
Ontstaat als 2 of meer peptiden samen een eiwit vormen. Vb: hemoglobine

15 Proteïnesynthese als resultaat van genexpressie
4

16 In de kern bevinden zich DNA-moleculen die de genetische codes bevatten voor de erfelijke kenmerken. Bij de mens vinden we er 46 DNA-moleculen per cel. KERN CYTOPLASMA DNA

17 Messenger-RNA (boodschapper-RNZ voor een bepaald eiwit) wordt gemaakt, overeenkomstig met de DNA-codes. De DNA-helix ontplooit zich op de plaats waar de genetische codes liggen voor de aanmaak van een bepaald eiwit. In de kern bevinden zich DNA-moleculen, waarvan er hier één is afgebeeld. Het is een dubbelstreng (helix). CYTOPLASMA KERN DNA m-RNA

18 m-RNA wordt losgekopppeld van DNA en de DNA-helix sluit zich weer.
CYTOPLASMA KERN DNA m-RNA

19 m-RNA verlaat de celkern via de kernporiën.

20 m-RNA schuift in ribosomen binnen.
Ribosoom m-RNA KERN Ruw endoplasmatisch reticulum

21 De eiwitten kunnen terecht komen in het endoplasmatisch reticulum.
Ribosoom KERN m-RNA Eiwit Ruw endoplasmatisch reticulum

22 De eiwitten kunnen de cel verlaten.
Ribosoom KERN m-RNA Eiwit Ruw endoplasmatisch reticulum

23 Eiwitsynthese DNA >>>>>>> m-RNA>>>>>>> eiwit Transcriptie speelt zich af in de kern Translatie speelt zich af in het cytoplasma

24 Basensequentie in DNA (gen) Basensequentie in mRNA
4.1 Basensequentie in DNA (gen) Basensequentie in mRNA transcriptie

25  Knipenzym X  Knipenzym Y TACCATACTTATATATGCTTTTGTGGGAATT
Benodigdheden DNA TACCATACTTATATATGCTTTTGTGGGAATT ATGGTATGAATATATACGAAAACACCCTTAA m-RNA-polymerase  Knipenzym X  Knipenzym Y

26 Waterstofbruggen worden verbroken.
DNA bestaat uit een aaneenschakeling van nucleotiden (Nucleotide = desoxyribose + fosfaat + organische base). Alleen de organische basen zijn afgebeeld. Waterstofbruggen worden verbroken. TACCATACTTATATATGCTTTTGTGGGAATT 3 waterstofbruggen tussen Guanine en Cytosine 2 waterstofbruggen tussen Adenine en Thymine ATGGTATGAATATATACGAAAACACCCTTAA

27 precursor messenger-RNA
m-RNA-polymerase schuift over DNA-enkelstreng en maakt precursor m-RNA via een polymerisatieproces. TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA precursor messenger-RNA ATGGTATGAATATATACGAAAACACCCTTAA

28 precursor messenger-RNA
TACCATACTTATATATGCTTTTGTGGGAATT AUGGUAUGAAUAUAUACGAAAACACCGUUAA precursor messenger-RNA ATGGTATGAATATATACGAAAACACCCTTAA

29 TACCATACTTATATATGCTTTTGTGGGAATT
AUGGUAUGAAUAUAUACGAAAACACCGUUAA ATGGTATGAATATATACGAAAACACCCTTAA

30 precursor messenger-RNA
TACCATACTTATATATGCTTTTGTGGGAATT ATGGTATGAATATATACGAAAACACCCTTAA precursor messenger-RNA AUGGUAUGAAUAUAUACGAAAACACCGUUAA

31 precursor messenger-RNA
DNA TACCATACTTATATATGCTTTTGTGGGAATT ATGGTATGAATATATACGAAAACACCCTTAA precursor messenger-RNA AUGGUAUGAAUAUAUACGAAAACACCGUUAA

32 precursor messenger-RNA
Bepaalde stukken zullen uit dit RNA geknipt worden door bepaalde enzymen. Dit proces heet splicing. Alzo wordt precursor messenger-RNA het uiteindelijke messenger-RNA (mRNA). AUGGUAUGAAUAUAUACGAAAACACCGUUAA Splicing

33 precursor messenger-RNA
Exon Exon = Expressed region AUGGUA UAUAUACGAAAACACCGUUAA UGAA Intron

34 AUGGUACGAAAACACCGUUAA
messenger-RNA m-RNA bestaat uit aan elkaar geschakelde nucleotiden (nucleotide = ribose + fosfaat + organische base). AUGGUACGAAAACACCGUUAA De organische basen zijn: U: uracil (i.p.v. thymine bij DNA) A: adenine G: guanine C: cytosine

35 Precursor-RNA kan vele introns bevatten!

36 Basensequentie in mRNA Aminozuursequentie in polypeptide
Translatie Translatie: vertaling van m-RNA tot eiwit. Basensequentie in mRNA Aminozuursequentie in polypeptide translatie

37 AUG GUA CGA AAA CAC CGU UAA
Benodigdheden m-RNA Codon Codon Codon Codon Codon Codon Codon AUG GUA CGA AAA CAC CGU UAA RF RF = Release Factor Anti-codon t-RNA UAC CAU GCU ribosoom Aminozuur 30 S UUU GUG GCA 50 S

38 mRNA-codons >> aminozuur

39 Andere voorstelling: aflezen van binnen naar buiten. 5’  3’

40 Transfer-RNA (tRNA) Elk tRNA bezit een anticodon (triplet) dat complementair is met een codon (triplet) van het mRNA Elk tRNA heeft een bindplaats voor een aminozuur (3’)

41 AUG GUA CGA AAA CAC CGU UAA
Een codon (triplet) komt overeen met een bepaald aminozuur of duidt start en stop aan. AUG GUA CGA AAA CAC CGU UAA UAA = stopcodon Arginine Histidine Lysine Arginine Valine Methionine AUG = startcodon

42 AUG GUA CGA AAA CAC CGU UAA
AUG = startcodon AUG GUA CGA AAA CAC CGU UAA UAC Met CAU Val Het m-RNA zal doorheen het ribosoom schuiven om de codons (3 basen) af te lezen en te vertalen in de overeenstemmende aminozuren, die aangebracht worden door t-RNA. Deze aminozuren worden aan elkaar gekoppeld tot een eiwit. Translatie: in 5’ ’ richting van mRNA

43 AUG GUA CGA AAA CAC CGU UAA
CAU Val Met

44 AUG GUA CGA AAA CAC CGU UAA
CAU UAC Val Met

45 AUG GUA CGA AAA CAC CGU UAA
CAU GCU Arg UAC Val Met

46 AUG GUA CGA AAA CAC CGU UAA
CAU GCU UAC Arg Val Met

47 AUG GUA CGA AAA CAC CGU UAA
GCU UUU Lys CAU UAC Arg Val Met

48 AUG GUA CGA AAA CAC CGU UAA
GCU UUU CAU UAC Lys Arg Val Met

49 AUG GUA CGA AAA CAC CGU UAA
UUU GUG His GCU CAU UAC Lys Arg Val Met

50 AUG GUA CGA AAA CAC CGU UAA
UUU GUG GCU CAU UAC His Lys Arg Val Met

51 AUG GUA CGA AAA CAC CGU UAA
GUG GCA Arg UUU GCU CAU His UAC Lys Arg Val Met

52 AUG GUA CGA AAA CAC CGU UAA
GUG GCA UUU GCU CAU Arg UAC His Lys Arg Val Met

53 AUG GUA CGA AAA CAC CGU UAA
RF GCA GUG UUU GCU Arg CAU His UAC Lys Arg Val Met

54 AUG GUA CGA AAA CAC CGU UAA
RF GCA GUG UUU GCU CAU Arg UAC His Lys Arg Val Met

55 AUG GUA CGA AAA CAC CGU UAA
GCA GUG UUU GCU RF CAU Arg UAC His Lys Arg Val Met

56 AUG GUA CGA AAA CAC CGU UAA
CAU GCU RF t-RNA-molecylen worden weer voorzien van hun juiste aminozuren UUU GUG GCA EIWIT Arg His Lys Val Arg Met

57 EIWIT Arginine Histidine Methionine kan afgeknipt worden. Lysine
Valine Arginine Methionine

58 Aan elkaar geschakelde aminozuren
EIWIT Aan elkaar geschakelde aminozuren m-RNA codons  Aminozuur UAA  Stop CGU  Arginine CAC Histidine AAA  Lysine CGA  Arginine GUA  Valine AUG  Methionine / Start Arginine Histidine Valine Lysine

59 Voorbeeld in het handboek (p. 68 …)
Synthese van de proteïne oxytocine (hormoon) Contractie baarmoeder tijdens de bevalling Contractie baarmoeder na bevalling Contractie spiertjes rond de melkklieren  Aanmaak in de hypothalamus

60 transcriptie

61 translatie Volledige mRNA voor oxytocine
5’ GAGGGGAAAUCUGAUGUGCUACAUACAGAACUGUCCCCUCGGCUAG 3’ De eerste nucleotiden vÓÓr het startcodon AUG worden niet vertaald in aminozuren. De translatie begint dus vanaf het startcodon AUG (vorming van het startcomplex).

62 Binding van aminozuren aan specifieke tRNA’s door enzymen.

63 Vorming van het startcomplex
5’ AUG UGC UAC AUA CAG AAC UGU CCC CUC GGC UAG 3’ Vorming van het startcomplex

64 Met Cys Tyr Ile Gln Asn Cys Pro Leu Gly Stop
5’ AUG UGC UAC AUA CAG AAC UGU CCC CUC GGC UAG 3’ Met Cys Tyr Ile Gln Asn Cys Pro Leu Gly Stop

65

66 Einde van de translatie: stopcodon (UAG)
release factor (RF) Methionine wordt afgeknipt + transport naar golgicomplex

67 Vorming van polysomen Parelsnoer van ribosomen op één mRNA-streng

68 4.4 Overzicht verloop proteïnesynthese
Voorbeeld : vorming van oxytocine de basensequentie van het DNA-fragment (gen) voor oxytocine transcriptie in de celkern de basensequentie van een mRNA translatie in het cytosol een aminozuursequentie in een polypeptide opvouwing van de polypeptide de functionele proteïne oxytocine

69

70

71 Animaties eiwitsynthese
https://www.youtube.com/watch?v=M568QP1K3sM https://www.youtube.com/watch?v=5wMqHOf692E https://www.youtube.com/watch?v=7D6EqlL5VsA https://www.youtube.com/watch?v=nHM4UUVHPQM&spfreload=1

72 5 5.1 Alternatieve splicing van pre-mRNA
Eén gen, meerdere polypeptiden 5 O.b.v. één gen kunnen verschillende proteïnen gevormd worden! Hiervoor bestaan verschillende mechanismen: 5.1 Alternatieve splicing van pre-mRNA Letters: exons Cijfers: introns

73

74 5.2 Meerdere startplaatsen voor transcriptie

75 Eén gen  verschillende eiwitproducten
5.3 Modificatie van proteïnen na translatie Na de translatie kunnen : Polypeptideketens doorgeknipt worden Sacharideketens aangehecht worden Fosfaatgroepen aangehecht worden Eén gen  verschillende eiwitproducten Voorbeeld: aanmaak van insuline Door afsplitsing van de C-peptide wordt actieve insuline gevormd. C-peptide krijgt een aparte functie (doorbloeding stimuleren)

76 6 Definitie van een gen bijsturen
Een gen is een eenheid van overerving en heeft een chromosomale locus. Het is een DNA-fragment dat de code bevat voor de aanmaak van één of meer polypeptiden of voor de aanmaak van een RNA-molecule Human Genome Project

77 7 7.1 Noodzaak van regulatie van genexpressie
Elke cel van een organisme bevat het volledige DNA Niet elk gen komt in elke cel tot expressie bv. genen voor insulineproductie komen enkel in bepaalde pancreascellen tot expressie Sommige genen komen slechts tijdelijk tot expressie in een bepaalde cel bv. genen voor melkeiwitten in borstkliercellen De intensiteit van de genexpressie kan variëren

78 7.2 Opbouw van een expressie-eenheid
Gen: onderdeel van een combinatie van verschillende DNA-fragmenten die samen een expressie-eenheid vormen. Transcriptie-eenheid (=structuurgenen) Basensequentie van 1 of meerdere naast elkaar gelegen genen Promotor Kort stuk DNA dat dient als startsignaal voor transcriptie Regulatorgenen (= regelgenen) Coderen voor proteïnen die transcriptie van structuurgenen beïnvloeden

79 7.3 Regulatie van genexpressie bij prokaryoten
Prokaryoten moeten zich zeer snel kunnen aanpassen aan wijzigingen in hun milieu  genregulatie door repressie en inductie Operon Bij prokaryoten liggen, functioneel bij elkaar horende structuurgenen, vlak bij elkaar, onder controle van 1 gemeenschappelijke promotor.  Volledige expressie-eenheid = operon

80 7.3.2 Genregulatie door repressie en inductie
Voorbeeld: regulatie lactose-metabolisme bij E. coli Geen lactose aanwezig: lac-operon met repressor Wel lactose aanwezig: lac-operon met inductor

81 7.4 Regulatie van genexpressie bij eukaryoten
Genenbatterijmodel voor transcriptieregulatie De transcriptie wordt gereguleerd door een integratorgen dat zelf onder controle staat van een sensor die gevoelig is voor moleculaire signalen van oa. hormonen Integratorgen ≈ regulatorgen bij prokaryoten Receptorgen ≈ operator bij prokaryoten

82 Dubbele helix onder de duim??
De epigenetische code Dubbele helix onder de duim?? Verborgen erfelijke code laat genen zwijgen DNA-code is de blauwdruk van het leven maar.. De volgorde van de vier bouwstenen van de dubbele helix is niet het enige wat iemands erfelijke eigenschappen bepaalt. Zelfs wat de moeder eet tijdens de zwangerschap kan invloed hebben!

83 Allerlei epigenetische ‘labels’ fungeren als een soort volumeknop waarmee de activiteit van de genen kan gereguleerd worden

84 organisatie chromatine
euchromatine Nucleosomen verder uit elkaar Genexpressie mogelijk heterochromatine DNA sterk gecondenseerd

85

86 onderdrukken  bv. methyl (CH3) bevorderen bv. acetyl (COCH3) 
chemische labels aan de histonen Chemische aanhangsels op de histonen kunnen de expressie van genen … onderdrukken bv. methyl (CH3) bevorderen bv. acetyl (COCH3)

87

88 Gen gedeactiveerd metylmerkers op DNA ACTACGAGTAGGATTTTCGATCGTCCCA
Metylgroepen hechten zich op een nucleotide C die gevolgd wordt door een nucleotide G H H-C-H H H H-C-H ACTACGAGTAGGATTTTCGATCGTCCCA Gen gedeactiveerd

89

90 transposons ‘jumping genes’
Klonen zichzelf en sturen kopieën over het ganse genoom. (oa. afkomstig van virussen) kunnen in genen terechtkomen en mutaties veroorzaken of genexpressie onderdrukken of stimuleren DNA beschermt zich hiertegen door methylering

91

92 imprinting Imprinting beïnvloed genen in de gameten waardoor die genen inactief worden. Bij maternale imprinting wordt het gen dat van moeder is geërfd inactief gemaakt en komt dat van vader juist tot uitdrukking. Imprinting van het gen van vaders kant (paternale imprinting) zorgt ervoor dat het gen vaders kant inactief wordt en dat van moeder tot uitdrukking komt.

93 hypotetisch voorbeeld van imprinting
Links: maternale imprinting voor het gen (genen) voor huidskleur; het ‘blank-gen’ van de moeder komt niet tot expressie bij de nakomelingen Rechts: paternale imprinting

94 lijger

95 Lijger ♀ : tijger ♂ : leeuw Tot 500 kg!

96 ♂ tijger x ♀ leeuw teeuw

97 RNA-interferentie (RNAi)
Genonderdrukking door dubbelstrengs RNA. Micro-RNA (miRNA) zijn kleine ‘antisense’-sequenties in het cytoplasma die zich kunnen binden met het mRNA (‘sense’-sequentie) Hierdoor ontstaat dubbelstrengs-RNA (dsRNA) Dit dsRNA bindt zich dan aan een eiwitcomplex Dicer (=‘snijmachine’) dat het in kleinere stukken hakt  er is geen translatie mogelijk Regelt oa. apoptose en celdifferentiatie

98 Schema RNA-interferentie

99

100 einde


Download ppt "Moleculaire mechanismen van genexpressie"

Verwante presentaties


Ads door Google