De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

BIO 42 Translatie of de synthese van eiwitten. Alle processen van het centrale dogma weergegeven voor een prokaryoot en voor een eukaryoot TRANSCRIPTION.

Verwante presentaties


Presentatie over: "BIO 42 Translatie of de synthese van eiwitten. Alle processen van het centrale dogma weergegeven voor een prokaryoot en voor een eukaryoot TRANSCRIPTION."— Transcript van de presentatie:

1 BIO 42 Translatie of de synthese van eiwitten

2 Alle processen van het centrale dogma weergegeven voor een prokaryoot en voor een eukaryoot TRANSCRIPTION TRANSLATION DNA mRNA Ribosome Polypeptide (a) Bacterial cell Nuclear envelope TRANSCRIPTION RNA PROCESSING Pre-mRNA DNA mRNA TRANSLATION Ribosome Polypeptide (b) Eukaryotic cell

3 Genen komen tot expressie

4 Wat doen die RNA moleculen? een mRNA wordt vertaald in een eiwit tRNA’s en rRNA’s helpen hierbij Eiwitten doen “alles” in een cel (opbouw membraan, enzymen, transport,….)

5 Protein-coding segment Polyadenylation signal 3 3 UTR5 UTR 5 5 Cap Start codon Stop codon Poly-A tail G PPPAAUAAA AAA … De opbouw van een mRNA Het bij de transcriptie verkregen transcript bevat o.a. het eiwit- coderende deel. De rest van het m-RNA bevat allemaal signalen die nodig zijn voor een correcte translatie.

6 Van DNA naar eiwit

7 Translatie transcriptie translatie

8 Hoe hebben ze gevonden dat er 3 nt’ s coderen voor 1 aminozuur? Redeneren: –Er zijn 4 verschillende nucleotiden in het DNA en in het mRNA –Er zijn 20 verschillende aminozuren in de cel waarmee eiwitten worden gemaakt –Als er 2 nucleotiden nodig zijn als code voor 1 aminozuur geeft dat …… verschillende codes (AA, AC, AG, GC, etc.) –Als er 3 nucleotiden nodig zijn geeft dat ……. verschillende codes (AAA, ACA, AGC, GCU, etc.)

9 Met behulp van in vitro experimenten heeft men dit probleem kunnen ontrafelen Toevoeging van poly-A aan een in vitro translatie systeem levert een eiwit op dat uitsluitend uit Lysines bestaat Poly-U leverde poly-Phe (=fenylalanine) op Poly-C leverde poly-Pro (=proline) op Poly-G leverde poly-Gly (=glycine) op Poly AGAGAG…. geeft dat een eiwit bestaande uit twee of drie aminozuren? Poly AGAGAG levert een eiwitketen op bestaande uit Arg en Glu. Etc.

10 Een van die in vitro experimenten in beeld gebracht: Het betreft allemaal in vitro experimenten Conclusie: –3 nucleotiden coderen voor 1 aminozuur. –De drie nucleotiden worden een tripletcode genoemd of codon –Alle codons bij elkaar vormen de genetische code.

11 De genetische code in beeld. Een eiwit begint met een AUG (= de code voor Methionine) Het einde van een eiwit wordt op het mRNA aangegeven met een stopcodon.

12 De genetische code geldt (in principe) voor alle organismen. De code wordt een gedegenereerde code genoemd, omdat er meerdere codes zijn voor 1 aminozuur.

13 De genetische code is universeel!!! Omdat de code universeel is kan DNA van het ene organisme tot expressie komen in een ander organisme. Dit wordt toegepast bij recombinant DNA technieken. (a) Tobacco plant expressing a firefly gene (b) Pig expressing a jellyfish gene

14 Codeert het onderstaande stuk DNA voor een eiwit?? 5’ ACGGATTCATGCAGTCAGACATATAGT TGCCTAAGTACGTCAGTCTGTATATCA 5’ TGCCTAAGTACGTCAGTCTGTATATCA 5’

15 Codeert het onderstaande stuk DNA voor een eiwit?? 5’ ACGGATTCATGCAGTCAGACATATAGT TGCCTAAGTACGTCAGTCTGTATATCA 5’ TGCCTAAGTACGTCAGTCTGTATATCA 5’

16 Codeert het onderstaande stuk DNA voor een eiwit?? 5’ ACGCATTGATGCAGTCAGACATATAGT TGCGTAACTACGTCAGTCTGTATATCA 5’ TGCGTAACTACGTCAGTCTGTATATCA 5’

17 Codeert het onderstaande stuk DNA voor een eiwit?? 5’ ACGCATTGATGCAGTCAGACATATAGT TGCGTAACTACGTCAGTCTGTATATCA 5’ TGCGTAACTACGTCAGTCTGTATATCA 5’

18 Hoe kan je in het DNA de plaats vinden waar er voor een eiwit wordt gecodeerd? Zoek in het DNA een promotor Zoek een ribosoombindingsplaats Zoek een startcodon (=ATG= AUG in mRNA) Zoek een zo lang mogelijk open leesraam = open reading frame = ORF Een ORF is een serie tripletcodes die start bij een ATG en (na lange tijd) beëindigd wordt met een stopcodon.

19 Een open leesraam zoeken. Een voorbeeld van de zoektocht naar open leesramen in een DNA sequentie.

20 Op een bepaald stuk DNA kunnen meerdere open leesramen voorkomen. De leesramen kunnen ook tegengesteld van richting zijn.

21 De uitvoering van de translatie: De translatie wordt uitgevoerd door ribosomen die het mRNA lezen. tRNAs brengen de aminozuren naar de actieve ribosomen toe. rRNAs zijn onderdeel van een ribosoom en spelen een rol bij de binding van het ribosoom aan het mRNA.

22 Hoe is een ribosoom opgebouwd? Een ribosoom is een complex van eiwitten en RNA’s. Dit wordt een riboproteincomplex genoemd. Het RNA wordt rRNA genoemd. Dit wordt gemaakt in de nucleolus in de kern. Er zijn 3 soorten rRNA. Een ribosoom bestaat uit twee subeenheden: de kleine en de grote subeenheid De kleine subeenheid bevat 1 rRNA en meer dan 20 eiwitten De grote subeenheid bevat de andere 2 rRNAs en meer dan 30 eiwitten De nucleolus in beeld

23 Ter illustratie: De complexe opbouw van de ribosomale subeenheden bij een prokaryoot en bij een eukaryoot meer in detail

24 De translatie stap voor stap. In elk ribosoom zijn 3 plaatsen te onderscheiden voor de binding van een tRNA

25 tRNAs Een tRNA brengt de aminozuren naar het ribosoom. Er zijn 45 verschillende tRNA’s in iedere cel aanwezig, die 20 aminozuren brengen en 57 codes in het mRNA kunnen/ moeten lezen. Een tRNA is een ssRNA met een specifieke 3-D structuur. Met het anticodon bindt het tRNA aan een complementair codon. Hoe herkent een tRNA de juiste code????

26 Het specifiek binden van een aminozuur aan een tRNA gebeurt in het cytoplasma door het enzym aminoacyl-tRNA synthetase. Sommige tRNA’s kunnen aan meerdere tripletcodons binden. Dit wordt de wobble- hypothese (wordt volgend jaar besproken) genoemd.

27 De start van de translatie: De translatie start met de binding van de kleine subeenheid aan het mRNA. De initiator-tRNA (de tRNA met Methionine eraan) bindt aan het startcodon (AUG) Vervolgens bindt de grote subeenheid en kan de eiwitsynthese beginnen.

28 De verschillende acties tijdens de synthese (ookwel elongatie genoemd).

29 De translatie eindigt bij een stopcodon (UAA, UAG of UGA).

30 Nogmaals de translatie in beeld: bovenste plaatje = een EM-opname onderste plaatje = schematische weergave

31 In de een prokaryoot vinden alle processen in 1 ruimte plaats. Bovendien zijn de transcriptie en de translatie (aan elkaar) gekoppeld; ze vinden tegelijk plaats. In een eukaryoot is de transcriptie in de kern en de translatie in het cytoplasma; beide processen vinden niet tegelijk plaats. TRANSCRIPTION TRANSLATION DNA mRNA Ribosome Polypeptide (a) Bacterial cell Nuclear envelope TRANSCRIPTION RNA PROCESSING Pre-mRNA DNA mRNA TRANSLATION Ribosome Polypeptide (b) Eukaryotic cell

32 De gekoppelde transcriptie-translatie bij een prokaryoot in beeld.

33 De synthese van eiwitten op vrije en gebonden ribosomen. Eiwitten die door de gebonden ribosomen worden gemaakt komen in het ER terecht, vanwaar uit ze naar verschillende organellen in de cel of naar buiten worden verstuurd. Op de vrije ribosomen worden vooral eiwitten gemaakt die in het cytoplasma blijven.

34 De synthese van eiwitten op het ruwe ER.

35 Posttranslationele processen Na de translatie zijn er in een eukaryoot nog een aantal posttranslationele activiteiten, zoals bv. het vastmaken van suikergroepen aan eiwitten (= glycosylering) of het opnemen van en metaal groep, zoals bij haemoglobine, of ……

36 Het effect van verschillende mutaties op de aminozuursamenstelling

37 Het gevolg van een puntmutatie voor de opbouw van een eiwit

38 Het effect van een mutatie op de eiwitsynthese is heel duidelijk te zien bij sickelcel anemie.

39 Tot slot: een “Overall” beeld van de transcriptie en de translatie in een eukaryoot

40 Zie de eindeisen Maak de opdrachten Einde


Download ppt "BIO 42 Translatie of de synthese van eiwitten. Alle processen van het centrale dogma weergegeven voor een prokaryoot en voor een eukaryoot TRANSCRIPTION."

Verwante presentaties


Ads door Google