De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

1 Ontwerp van een hardware-versneller voor de vergelijking van DNA-sequenties Promotoren: Prof. Stroobandt (ELIS) Prof. Van de Peer (PSB) Begeleiders:

Verwante presentaties


Presentatie over: "1 Ontwerp van een hardware-versneller voor de vergelijking van DNA-sequenties Promotoren: Prof. Stroobandt (ELIS) Prof. Van de Peer (PSB) Begeleiders:"— Transcript van de presentatie:

1 1 Ontwerp van een hardware-versneller voor de vergelijking van DNA-sequenties Promotoren: Prof. Stroobandt (ELIS) Prof. Van de Peer (PSB) Begeleiders: Philippe Faes, Mark Christiaens, Joni Dambre (ELIS) Eric Bonnet, Yvan Saeys (PSB) Bram Minnaert – BC3CA

2 2 Overzicht Probleemstelling Algoritmes HW/SW-partitionering Hardware-ontwerp Resultaten Besluit Vragen

3 3 Overzicht Probleemstelling Algoritmes HW/SW-partitionering Hardware-ontwerp Resultaten Besluit Vragen

4 4 Probleemstelling Bio-informatica: gelijkenissen opsporen tussen DNA-sequenties Problemen: Grote databanken DNA-sequenties zijn lang Algoritmes zijn tijdrovend Aantal sequenties hardware-implementatie op FPGA

5 5 Probleemstelling Typisch gebruik: All-against-all in databank (30.000) Heuristiek Verschillende dagen Lengte DNA-sequenties Gemiddeld ~ nucleotiden Grote variatie nucleotiden

6 6 Probleemstelling Zoek de optimale alignering CGTCAGT || | | ACG —— AATC CG —— TCAGT || || ACGAATC CGTCAGT ACGAATC Gelijkheid Ongelijkheid Verwijdering Inlassing => gelijkenisscore => gelijkeniskost => gatenkost

7 7 Probleemstelling Zoek de optimale alignering CGTCAGT || | | ACG —— AATC CG —— TCAGT || || ACGAATC CGTCAGT ACGAATC = =14 Gelijkheid Ongelijkheid Verwijdering Inlassing => +5 => -2 => -3

8 8 Overzicht Probleemstelling Algoritmes HW/SW-partitionering Hardware-ontwerp Resultaten Besluit Vragen

9 9 Smith-Waterman Algoritme C T A A G C 0C ACTGC max diagonaal + gelijkenis boven + gatenkost links + gatenkost 0

10 10 Smith-Waterman Algoritme C T A A G C 0C ACTGC max diagonaal + (gelijk? +5 : -2) boven - 3 links -3 0

11 11 Smith-Waterman Algoritme C T A A G C C ACTGC

12 12 Smith-Waterman Algoritme 14C T A A G C C ACTGC CG——TCA || || CCGAATC

13 13 Smith-Waterman Algoritme Probleem: O ruimtecomplexiteit O ( N 2 ) Software: ~510 MB voor X  Niet geschikt voor hardware-implementatie

14 14 Geheugen besparen A A 33 C T G T C C G T TTCTCCTGTACCTAAGGAGCA 0 0

15 15 Uitbreiding algoritme Zowel DNA- als eiwitsequenties 4 nucleotiden (A, C, G, T) 20 aminozuren

16 16 Uitbreiding algoritme Substitutiematrix ACGT A5-2-3 C-2301 G T-31-55

17 17 Uitbreiding algoritme Affiene gatenmodel penalty gaps

18 18 Overzicht Probleemstelling Algoritmes HW/SW-partitionering Hardware-ontwerp Resultaten Besluit Vragen

19 19 HW/SW-partitionering Zoek eindpunt Zoek beginpunt Vind alignering O O ( N 2 ) O O ( L 2 )

20 20 HW/SW-partitionering L N

21 21 HW/SW-partitionering L N

22 22 HW/SW-partitionering L N log

23 23 HW/SW-partitionering Zoek eindpunt Zoek beginpunt Vind alignering O O ( N 2 ) O O ( L 2 )

24 24 HW/SW-partitionering Zoek eindpunt Zoek beginpunt Vind alignering O O ( N 2 ) O O ( ( log( N ) ) 2 ) HARDWARE

25 25 HW/SW-partitionering

26 26 Overzicht Probleemstelling Algoritmes HW/SW-partitionering Hardware-ontwerp Resultaten Besluit Vragen

27 27 Afhankelijkheden

28 28 Afhankelijkheden

29 29 Overzicht Probleemstelling Algoritmes HW/SW-partitionering Hardware-ontwerp Resultaten Besluit Vragen

30 30 Resultaten Succes 56 cellen / klokcyclus MHz Versnelling = 288

31 31 Resultaten Logische eenheden

32 32 Resultaten RAM 59% Maximumlengte DNA 86,3% Eiwitten 99,9% Oplossingen Herconfigureren Logische eenheden beperken

33 33 Resultaten

34 34 Resultaten

35 35 Overzicht Probleemstelling Algoritmes HW/SW-partitionering Hardware-ontwerp Resultaten Besluit Vragen

36 36 Besluit FPGA Wordt vervolgd…

37 37 Overzicht Probleemstelling Algoritmes HW/SW-partitionering Hardware-ontwerp Resultaten Besluit Vragen


Download ppt "1 Ontwerp van een hardware-versneller voor de vergelijking van DNA-sequenties Promotoren: Prof. Stroobandt (ELIS) Prof. Van de Peer (PSB) Begeleiders:"

Verwante presentaties


Ads door Google