De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

1 e-DNA of Environmental-DNA: een krachtig instrument voor het monitoren van (water)organismen? Joachim Mergeay INBO ANKONA, 8.02.2014 Foto: D. Piliod.

Verwante presentaties


Presentatie over: "1 e-DNA of Environmental-DNA: een krachtig instrument voor het monitoren van (water)organismen? Joachim Mergeay INBO ANKONA, 8.02.2014 Foto: D. Piliod."— Transcript van de presentatie:

1 1 e-DNA of Environmental-DNA: een krachtig instrument voor het monitoren van (water)organismen? Joachim Mergeay INBO ANKONA, Foto: D. Piliod

2 Iedereen laat sporen na eDNA = environmental DNA = ?? Jelger Herder, Ravon

3 Vijvers & rivieren: soep met lettertjes Orde in de soep krijgen: wat zit er in?

4 DNA barcodes: de genetische ID van elk organisme DNA barcodes: de genetische vingerafdruk van elk organisme alfabet met slechts vier letters: A, C, T, G Informatie in slechts tien letters: 4 10 > 1 miljoen unieke combinaties Typische DNA barcode: 670 letters lang, één gen bij dieren van mtDNA

5 DNA barcodes: de genetische ID van elk organisme DNA barcodes: de genetische vingerafdruk van elk organisme alfabet met slechts vier letters: A, C, T, G Informatie in slechts tien letters: 4 10 > 1 miljoen unieke combinaties Typische DNA barcode: 670 letters lang, één gen bij dieren van mtDNA

6 DNA barcodes: de genetische ID van elk organisme DNA barcodes: de genetische vingerafdruk van elk organisme alfabet met slechts vier letters: A, C, T, G Informatie in slechts tien letters: 4 10 > 1 miljoen unieke combinaties Principe voor herkenning soorten: Verschillen tussen soorten >> binnen soorten

7 DNA barcodes: de genetische ID van elk organisme DNA barcodes: de genetische vingerafdruk van elk organisme alfabet met slechts vier letters: A, C, T, G Informatie in slechts tien letters: 4 10 > 1 miljoen unieke combinaties Principe voor herkenning soorten: Verschillen tussen soorten >> binnen soorten

8 DNA barcodes: de genetische ID van elk organisme DNA barcodes: de genetische vingerafdruk van elk organisme alfabet met slechts vier letters: A, C, T, G Informatie in slechts tien letters: 4 10 > 1 miljoen unieke combinaties Principe voor herkenning soorten: Verschillen tussen soorten >> binnen soorten

9 DNA barcoding

10 DNA barcoding test Bv. welke haaien in haaienvinnensoep?

11 DNA barcoding test Is walvisvlees in Japan “voor wetenschappelijk onderzoek” welk enkel afkomstig van dwergvinvis? Waar komt het nog voor?

12 Andere fingerprinting testen

13 DNA barcodes: de genetische ID van elk organisme DNA barcodes: de genetische vingerafdruk van elk organisme alfabet met slechts vier letters: A, C, T, G Informatie in slechts tien letters: 4 10 > 1 miljoen unieke combinaties Toewijzing van onbekend staal: vergelijken met referentie-databank Bv. Vleermuiskeutel uit Eijsden (Daan Dekeukeleire) DNA fragment: ATGACCAACATTCGAAAATCTCACCCCCTATTAAAAATTATCAACAGCTCATTCATTGACCTTCCTG CCCCATCAAACATCTCATCCTGATGAAACTTTGGATC Vergelijking in BLAST Databank:

14 DNA barcoding test Bv. Vleermuiskeutel uit Eijsden (Daan Dekeukeleire)

15 DNA barcoding test Bv. Vleermuiskeutel uit Eijsden (Daan Dekeukeleire)

16 Detectie DNA en vermeerdering Maakt gebruik van zogenaamde “primerparen”: twee korte stukjes DNA met een welbepaalde code die enkel op de complementaire code kunnen binden, en die niet te ver van elkaar te vinden zijn in het DNA.  Zoekfunctie in een digitale tekst: de query moet lang genoeg zijn om een uniek resultaat te geven. Na binden van primers: biochemische vermeerdering van het stukje tussenliggende tekst: van 1 streng naar 1 miljard op 2 uur tijd. Enkel als de twee stukjes aanwezig zijn in elkaars buurt treedt er vermeerdering op. Met 4 letters: primers zijn c letters lang.

17 DNA versus eDNA eDNA: snelle afbraak in de omgeving  DNA wordt in stukjes geknipt : geen lange teksten lezen!  “potscherven” <100 letters.  Zeer weinig DNA : gevoelige methode!  1 streng DNA …  Techniek als bij oud DNA (bv. Neanderthaler, holenleeuw, …) Zeer gevoelige methodes ook zeer gevoelig voor fouten… 1 fout stukje DNA bij aanvang  10 9 op einde…

18 Contaminatie… Methode extreem gevoelig geen DNA in staal dat er niet hoort te zijn bij staalname: laarzen, handschoenen, flesjes, filters, tubes, pipetten, reagentia… bij analyse: rondzwevend DNA !  Zeer specifieke, gescheiden laboratoria waar je enkel van hoog-risico naar laag-risico kan bewegen langsheen overdruiksluizen zonder decontaminatie.  Decontaminatie via luchtdouches, UV-sterilisatie, chemische DNA- verwijdering, …

19 eDNA in de praktijk eDNA barcoding: zoeken naar specifieke soort bv. Stierkikker, kamsalamander, grote modderkruiper, zwemmersjeuk, otter, … eDNA metabarcoding: welke soorten aanwezig? selectie van primers veel moeilijker per soortgroep op alle soorten tussenliggende DNA moet soorten onderscheiden Nieuwe methodes: elke streng DNA wordt gelezen  10 9 fragmenten die worden geïdentificeerd  bio-informatische uitdaging

20 eDNA barcoding: Stierkikker Stierkikker in Frankrijk Eerste studie naar eDNA LECA, Frankrijk (Ficetola et al. 2008) Vervolg in Dejean et al. (2012) 49 locaties: traditionele monitoring versus eDNA 3 stalen per locatie 3 analyses per staal

21 eDNA barcoding: Stierkikker Klassieke waarnemingeneDNA Bron slide: E. Bellemain, Spygen

22 eDNA barcoding: knoflookpad NL, RAVON 35 overblijvende populaties, 23 locaties: vermoedelijk verdwenen Moeilijk te inventariseren Info nodig voor soortbescher- mingsprogramma eDNA: 6/23 nog aanwezig Foto: Guido Kreiner

23 eDNA barcoding: overzicht Thomsen et al. 2011

24 eDNA barcoding: Zilverkarper & Grootkopkarper Jerde et al & ECALS 2013

25 eDNA barcoding: Zilverkarper & Grootkopkarper

26

27 Dure electrische dam om invasieve vissen tegen te houden: Werkt de dam wel?  eDNA

28 eDNA barcoding: Zilverkarper & Grootkopkarper Dure electrische dam om invasieve vissen tegen te houden: Werkt de dam wel?  eDNA

29 eDNA barcoding: Zilverkarper & Grootkopkarper ECALS 2013 rapport (US Army Corps of Engineers): Na inmenging hooggerechtshof Positieve detectie in rivier mogelijk gevolg van visetende vogels, visserijsector (netten!), etc. Belangrijke les: we detecteren DNA, geen vissen!!

30 eDNA barcoding: Zilverkarper & Grootkopkarper “The electric barrier in the Chicago Sanitary and Ship Canal (CSSC) will be shut down for two to five days in early December for routine maintenance, providing an opportunity for the Asian carp to advance up the canal toward Lake Michigan. The electric barrier is currently the only protection against carp entering Lake Michigan via the CSSC. eDNA evidence suggests the Asian Carp are already very close to the electric barrier in the CSSC and are also present in the Des Plaines River and I & M canal.”

31 eDNA barcoding: kwantitatief? Thomsen et al. 2011

32 eDNA barcoding: kwantitatief? Takahara et al. 2012: PLoS ONE

33 DNA metabarcoding: de hele gemeenschap Niet gericht op specifieke soorten Welke soorten zitten er? selectie van primers veel moeilijker per soortgroep op alle soorten tussenliggende DNA moet soorten onderscheiden Nieuwe methodes: elke streng DNA wordt gelezen  tot 10 8 fragmenten die worden geïdentificeerd en vergeleken met referentie-databank!  bio-informatische uitdaging

34 DNA metabarcoding: de hele gemeenschap Bv Ji et al. 2013: inventarisatie tropische insecten  Ongelooflijke expertenkennis nodig!!  Ofwel: pureren, en DNA metabarcoding: biodiversity soup

35 DNA metabarcoding: de hele gemeenschap “Here, we validate metabarcoding by testing it against three high-quality standard data sets that were collected in Malaysia (tropical), China (subtropical) and the United Kingdom (temperate) and that comprised 55,813 arthropod and bird specimens identified to species level with the expenditure of 2,505 person-hours of taxonomic expertise. The metabarcode and standard data sets exhibit statistically correlated alpha- and beta- diversities, and the two data sets produce similar policy conclusions for two conservation applications: restoration ecology and systematic conservation planning. Compared with standard biodiversity data sets, metabarcoded samples are taxonomically more comprehensive, many times quicker to produce, less reliant on taxonomic expertise and auditable by third parties, which is essential for dispute resolution”

36 DNA metabarcoding: Biotische indices Plannen van Uhasselt & INBO, ism VMM, PIH Metabarcoding van macro-invertebraten voor Biotische index en KRW + eDNA metabarcoding van waterstalen voor vissen voor KRW tal van uitdagingen!!  referentiedatabank van MI  stromend water  Visindex vraagt huidig kwalitatieve & kwantitatieve data Kunnen we semi-kwantitatief werken met eDNA metabarcoding? Is dit nodig voor goede index? Gedrag van eDNA in relatie tot tijd, temperatuur, pH, trofiegraad, …

37 DNA metabarcoding: Biotische indices Slide: E Bellemain, Spygen

38 eDNA metabarcoding Slide: E Bellemain, Spygen

39 eDNA metabarcoding vissen 3 waterstalen van 1.5 L in Denemarken (30 x 50 ml, elke 5 m 1 staal) 15 vissoorten, 1 dwaalgast (of zieke matroos?) 4 vogelsoorten (o.m. roodkeelduiker)

40 eDNA metabarcoding vissen 3 waterstalen van 1.5 L in Denemarken (30 x 50 ml, elke 5 m 1 staal) 15 vissoorten, 1 dwaalgast (of zieke matroos?) 4 vogelsoorten (o.m. roodkeelduiker)

41 eDNA metabarcoding vissen Vergelijking van efficiëntie van methodes met eDNA metabarcoding (Thomsen et al. 2012)

42 Niet enkel waterstalen! Truong Song Muntjac Schnell et al. 2012

43 Carrion flies therefore represent an extraordinary and thus far unexploited resource of mammal DNA, which will probably prove useful for future inventories of wild mammal communities

44 Niet enkel waterstalen! Slide: E Bellemain, Spygen

45 Niet enkel waterstalen! Calvignac-Spencer et al Slide: E Bellemain, Spygen

46 Samenvatting DNA, eDNA en (meta)barcoding  formidabel potentieel Groeiende wetenschappelijke gemeenschap Nog veel technische uitdagingen Bio-informatica-kennis is nog limiterend voor eigen toepassing Meeste studies tot nu: proof of principle: het kan Validatie is verder nodig om grenzen van kunnen af te tasten Routinematige toepassingen in het verschiet

47 Bijkomende bronnen Bijeenkomst__Environmental_DNA_en_monitoring_bij_waterbeheerders_

48 Dankwoord Eva Bellemain, Spygen Philip Thomsen, Centre for Geogenetics Jelger Herder, Ravon voor hun slides


Download ppt "1 e-DNA of Environmental-DNA: een krachtig instrument voor het monitoren van (water)organismen? Joachim Mergeay INBO ANKONA, 8.02.2014 Foto: D. Piliod."

Verwante presentaties


Ads door Google