De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

Werkzitting I Prof. F. Claessens. Wat studeren ? 1.Cursus + Toledo AR, dubbel hybride techniek, blotting etc... 2.Nota’s van de les + bord 3.Aanvullingen.

Verwante presentaties


Presentatie over: "Werkzitting I Prof. F. Claessens. Wat studeren ? 1.Cursus + Toledo AR, dubbel hybride techniek, blotting etc... 2.Nota’s van de les + bord 3.Aanvullingen."— Transcript van de presentatie:

1 Werkzitting I Prof. F. Claessens

2 Wat studeren ? 1.Cursus + Toledo AR, dubbel hybride techniek, blotting etc... 2.Nota’s van de les + bord 3.Aanvullingen in Lodish Hoe? 1. Begrijpen en begrippen 2. Definities 3. Schema’s structuren en tekeningen Begeleide zelfstudie 1. U moet zelf studeren, wij begeleiden 2. Zelfstudie: mol biol is moeilijk 3. Begrijpen, reproduceren en toepassen Wat te doen bij vragen Internet, google, wikipedia Collega’s Monitoraat: Koen Uyterhoeven of na de les: Frank Claessens

3 Hoe puntjes verdienen op 17 (09.00u) of 20 juni (14.00u) 2013: Practica tellen mee voor 2 van de 20 punten Deel FC op 9 Deel JVL op 9 Deel FC: 30 MKVs met 4 mogelijkheden waarvan slechts 1 juist Juist: 1 punt Blanco: geen punt Fout: -1/3 punt giscorrectie Het totaal wordt herrekend naar 10. Bij asymmetrische punten wordt geen credit gegeven

4 Tips voor de meerkeuzevragen: Deel je tijd goed in! Lees geconcentreerd de vraag en bedenk eerst wat je antwoord is zonder naar de antwoordmogelijkheden te kijken De helft van de vragen zijn relatief makkelijk Bij moeilijke vragen niet panikeren: met het examen moet ook het verschil maken tss goede, minder goede en excellente studenten Vul eerst op het vragenboekje in, daarna ‘in het net’ op het officiële antwoordformulier Schrap eerst de antwoorden die zeker fout zijn. Tips voor MKV op het net heb ik ook gelezen dus...

5 Teken een adenosine-thymidine paar zoals het voorkomt en georiënteerd is in een DNA strengen, en benoem de verschillende delen

6 ATP staat in kolom A, B, C of D; rij A,B, C of D OH

7 Als genomisch DNA van een soort 34% A bevat, wat kan u dan zeggen over de andere basen? Wat is het verschil tussen DNA en dnaA? Welke enzymatische eigenschappen bevat DNA polI? Waarom is de replicatievork asymmetrisch

8 Welk molecule is dit? Thymidine: nucleoside Thymine: base Azido 2’deoxy, 3’ azido thymidine Wat gebeurt er wanneer dit molecule (gefosforyleerde vorm) door het reverse transcriptase van HIV wordt gebruikt als substraat ?

9 Definities cAMP Alkaptonurie Conjugatie (animatie)animatie Telomerase

10 De volgorde waarin enzymen actief moeten zijn ter hoogte van de replicatievork is: A.primase, DNA pol III, DNA pol I, DNA ligase, helicase B.Helicase, primase, DNA pol III, DNA pol I, DNA ligase C.Helicase, primase, DNA polymerasen, DNA ligase, telomerase D.Helicase, DNA ligase, primase, DNA pol III, DNA pol I (animaties)animaties Enkele voorbeelden van MKVs

11 Welke van deze strengen zal eerst denatureren? A. GGCCATGGCGCCTGTACCGGG B. ATTACGATGTCCGGTAAGTAAT C. TATGCGCGGCC D. AATTGAATATT De E3 ligasen modificeren______ A. aminoterminale uiteinden van eiwitten. B. lysine zijketens. C. leucine zijketens. D. cysteine zijketens.

12 Garrod toonde met zijn onderzoek aan dat A. Elk individu twee gekoppelde genen heeft B. Xeroderma pigmentosum in verschillende complementatiegroepen kan worden onderverdeeld C. Afwijkingen in biochemische reacties erfelijk kunnen zijn D. Alkaptonurie een erfelijke aandoening is van de nieren RNA en DNA verschillen omdat A. Ribose een suiker is en deoxyribose niet B. Deoxyribose een –OH groep draagt op positie 2’ C. De adenine base enkel in DNA voorkomt D. RNA uracil bevat ipv thymine

13 Lapjeskatten kunnen mannelijk of vrouwelijk zijn Lapjeskatten hebben dezelfde kleuren als hun moeder Het lappenpatroon komt tot stand door willekeurig inactiveren en activeren van X-chromosomen Eéneiige tweelingen van lapjeskatten hebben identieke patronen Stellingen


Download ppt "Werkzitting I Prof. F. Claessens. Wat studeren ? 1.Cursus + Toledo AR, dubbel hybride techniek, blotting etc... 2.Nota’s van de les + bord 3.Aanvullingen."

Verwante presentaties


Ads door Google