De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

Glycering en Complicaties Bruce H.R. Wolffenbuttel Afdeling Endocrinologie UMC Groningen.

Verwante presentaties


Presentatie over: "Glycering en Complicaties Bruce H.R. Wolffenbuttel Afdeling Endocrinologie UMC Groningen."— Transcript van de presentatie:

1 Glycering en Complicaties Bruce H.R. Wolffenbuttel Afdeling Endocrinologie UMC Groningen

2 HbA1c is niet wat het lijkt …

3 UKPDS: hoger HbA 1c = meer complicaties, goede diabetesregulatie = minder complicaties! Complicaties 600 ogen, nieren % 300 hart/vaten ,07,08,09,010,0 HbA 1c (%)

4 Ons lichaam heeft een 'olifantengeheugen' voor hyperglycemie Langere follow-up (beide groepen Intensieve therapie bij type 1 nu intensieve behandeling) toont diabetes vertraagt complicaties verdere voordelen DCCT follow-up 2000 DCCT 1995

5 Snelle en langzame glycering glucose HbA 1c hemoglobine afbraak / eliminatie

6 Lage en hoge glycering - bij dezelfde bloedglucose veel hoger HbA 1c Laag 11 Normaal 10 Hoog Gemiddelde bloedglucose (mmol/l) Hempe JM, et al. J Diab Compl 2002

7 Hoge glyceerders ontwikkelen veel sneller complicaties van ogen en nieren hoge glycering van Hb komt tot uiting in andere weefsels, leidt tot meer eiwitglycering in weefsels en daardoor tot sneller optreden van ernstiger complicaties McCarter et al. Diabetes Care 2004

8 HbA1c is genetically determined HbA 1c nageTwin 1Twin 2Non-diabetic twins MZ concordant Men1236±1010.6± ±2.3 Women2135±810.4± ±2.95.7±0.4 MZ discordant Men2240±1210.2±2.06.7±1.0 Women2342±149.1±1.56.5±1.35.7±0.4

9 HbA1c is genetically determined concordant twinsdiscordant twins twin1 = diabetic twin 2 = diabetic twin 2 = non-diabetic Snieder et al. Diabetes 2001;50:

10 Het krijgen van complicaties is sterk erfelijk bepaald …….

11 Consequences of AGE formation 1. Receptor uptake cellular activation, amongst others possibly leading to atherosclerosis 2. Tissue accumulation on proteins in the blood vessels - afterload in the heart - diastolic dysfunction in the kidney - matrix changes in several collagenous tissues - LJM, CTS on lipid particles: makes them more atherogenic 3. Renal excretion related damage ??

12 'Stiff hand' syndroom en 'limited joint mobility' ControleDiabetes

13 Expressie van CML-AGE in diabetische nefropathie in mesangiale matrix, glomerulaire en tubulaire b.m., bloedvaten

14 Complicaties en erfelijkheid ? Slechts 30-50% ontwikkelt nephropathie, hoe slecht regulatie ook is Familiale clustering van complicaties kan door andere factoren dan genen beinvloed worden, bijv. omgevingfactoren Aanwezigheid (maar niet ernst) van nephropathie en ernst (maar niet aanwezigheid) van retinopathie bleek in families te clusteren (DCCT) Hoogste correlaties in de moeder/kind paren: kan wijzen op intrauteriene milieu, dan wel op maternaal overerfde elementen (mitochondriaal DNA)

15 Hyperglycemie Complicaties genen + omgeving AGE vorming hemodyn. lipiden PKC, Ang-II veranderingen bloeddruk VEGF, GH/IGF-1 Aldosereductase

16 The ACE I/D polymorphism

17 The ACE I/D polymorphism in diabetes Renal survival worse in type 2 diabetes with DD (Yoshida et al, Kidney Int 1996; 50: ) Kidney function worse in type 1 diabetes with DD (Marre et al, JCI 1997; 99: ) ACE-I larger therapeutic effect in type 1 diabetics with II polymorphism (Penno et al, Diabetes 1998; 21: 66-9; Jacobsen et al. Kidney Int 1998; 53: )

18 The ‘extreme phenotype’ approach Patients were included when they had: 1. no / mild retinopathy and diabetes duration ≥ 20 years 2. proliferative retinopathy and laser photocoagulation within 15 years of diagnosis

19 Patient characteristics No/mildDRPDR Age (yrs)52 ± 1243 ± 12p=0.04 Diabetes duration (yrs)32 ± 1023 ± 6p=0.03 Males/females15 / 1926 / 25ns 3-year avg. HbA1c (%)8.2 ± ± 1.1ns visual accuracy (VODS)0.90 ± ± 0.27 ns Prevalence of (%): hypertension1015ns macrovascular disease2015ns

20 ACE I/D polymorphism in proliferative diabetic retinopathy DDIDII Early PDR12166 < 15 yrs DM No/mild DR> yrs DMp=0.43 DD vs I12 / 22 vs 12 / 39p=0.17

21 RAGE polymorphisms RAGE polymorphismprimer sequenceT a [°C] Gly82Serfor.5’ GTAAGCGGGGCTCCTGTTGCA 3’63 rev.5’ GGCCAAGGCTGGGGTTGAAGG 3’ promotor region, 388bpfor.5’ CCCTGGGTTTAGTTGAGAATTTTT 3’61 upstream startrev.5’ CAGAGCCCCCGATCCTATTTA 3’ promotor region, 452 bpfor.5’ AAATATGGGTTGGGGTGCTT 3’61 upstream startrev.5’ CTGCATCATGAAGGCAAGG 3’ RAGE FragmentRestrictionTemperatureTime [hours] enzyme[°C] Gly82SerAlul372 promotor region, 388 bpTsp509l65 2 upstream start promotor region, 452 bpAlul37 1 upstream start

22 RAGE polymorphism in diabetic retinopathy PDRNo PDRP Exon 3 A/G (Gly82Ser)4 / 274 / Intron 7 G/T (1704G/T)5 / 2312 / PromotorTT 18TT 25. ? (388bp upstr T/A)AT 16AT 18, AA 5 Del/T 3 PromotorCC 4. ? (452bp upstr T/C) CT 6CT 14 TT 16TT 23 T/del 3 In eerste aanleg geen opvallende genetische invloed van RAGE, maar: 1. kleine steekproef 2. personen met ‘deletie’ laag VEGF en sICAM

23 Complicaties bij diabetes Het ontstaan van complicaties is een interactie van erfelijke aanleg en omgeving Specifieke complicaties hangen wsl. samen met specifieke erfelijke factoren Het zoeken naar genetische factoren is nog maar net begonnen Grote goed gedefinieerde patiëntengroepen zijn een voorwaarde voor adequaat genetisch onderzoek

24 AGEs meten ?

25 Pathways for AGE-formation and complications Glucose Schiff’s base Amadori AP-ene 3-deoxy dion glucoson Protein AGEs RAGE Tissues clearance Complications

26 Pathways for AGE-formation and complications Glucose Schiff’s base Triose-P auto-oxidation Amadori AP-ene 3-deoxy dion glucoson MG Protein AGEs RAGE Tissues clearance Complications

27 Pathways for AGE-formation and complications Glucose Schiff’s base Triose-PG3P auto-oxidation Amadori AP-ene 3-deoxy dion glucoson MG DAG Protein AGEs in AGEs food / smoke Tissues clearance RAGE PKC Complications

28 Pathways for AGE-formation and complications Glucose Schiff’s base Triose-PG3P auto-oxidation Amadori # # Oxygen # # free AP-ene 3-deoxy radicals dion glucoson # # MG # DAG Protein AGEs in AGEs food / smoke Tissues clearance RAGE PKC Complications

29 Verloop van HbA 1c en AGEs tijdens insuline behandeling bij personen met type 2 diabetes bloedglucose MGHI * * 8 HbA1c 15 6 * CML ns Tijd (maanden) CML = N ε -carboxymethyllysine, HPLC MGHI = Methylglyoxal-derived hydroimidazolone, DELFIA, monoclonaal a.l. * = P < 0.05 Mentink et al, Neth J Med 2006

30 Meetopstelling AGE-meter Kastje met de TL-lamp type ‘Black-light’ Computer SpectrometerOptische fiber

31 Alternatieve AGE-meting met licht excitatieemissie = Autofluorescentie LOG 0,1 (nm) ,01 Patient met veel Autofluorescentie dus veel AGEs 0,001 0, , Patient met weinig Autofluorescentie, dus weinig AGEs Autofluorescence ratio (AFr): AFr=mean Int ( ) mean Int ( )

32 Survival in hemodialysis patients with skin autofluorescence above and below mean values AFmean Years of follow-up Meerwaldt, 2004

33 Samenvatting HbA1c is niet wat het lijkt … Het ontstaan van complicaties is een interactie van erfelijke aanleg en omgeving Biochemische meting van AGEs (excl. HbA 1c ) is voorbehouden tot de research setting Meting van AGEs met licht lijkt attractief om de kans op diabetische complicaties beter in te schatten

34 Sources of variance in HbA1c (as % of total HbA1c variance) h 2 HbA1c, genetic variance component (heritability) specifically influencing HbA1c; h 2 glucose, genetic influence on HbA1c due to glucose; E 2 HbA1c, unique environmental variance component specifically influencing HbA1c; E 2 glucose, unique environmental influence on HbA1c due to glucose; age 2, variance component due to age.


Download ppt "Glycering en Complicaties Bruce H.R. Wolffenbuttel Afdeling Endocrinologie UMC Groningen."

Verwante presentaties


Ads door Google