De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

Klonering van grote DNA segmenten : P1, BAC, PAC, YAC vectoren. cfr. o.a. Primrose & Twyman : hfdst. 5 Cosmiden : inserts 30-45 kbp : selectie door inpakrestrictie.

Verwante presentaties


Presentatie over: "Klonering van grote DNA segmenten : P1, BAC, PAC, YAC vectoren. cfr. o.a. Primrose & Twyman : hfdst. 5 Cosmiden : inserts 30-45 kbp : selectie door inpakrestrictie."— Transcript van de presentatie:

1 Klonering van grote DNA segmenten : P1, BAC, PAC, YAC vectoren. cfr. o.a. Primrose & Twyman : hfdst. 5 Cosmiden : inserts kbp : selectie door inpakrestrictie in faag partikels Zoektocht naar fagen met grotere inpakmogelijkheden (o.a. T4) succesvol met faag P1 Gebruik van F-plasmide als replicon, samen met elektroporatie als DNA-transformatietechniek leidde in 1992 tot BAC vectoren. ('bacterial artificial chromosome') Combinatie van P1 en BAC eigenschappen leidde in 1994 tot PAC vectoren. ('P1-derived artificial chromosome'). Met BAC en PAC kunnen DNA segmenten tot 300 kb gekloneerd worden, hoewel (gezien er geen grootte-selectie is) vaak inserts van kb (of zelfs minder) bekomen worden. DNA isolatie, en intactheid, spelen uiteraard een belangrijke rol. Het concept (en terminologie) "artificial chromosome" was reeds in 1987 ontwikkeld in S. cerevisiae met de YAC vectoren.

2 Kloneren van grote fragmenten : cosmiden, P1, PAC, BAC, YAC - overzicht VectorCapaciteit Replicon Gastheer KopijenaantalIntroductie (kb) Cosmide ColE1 E. coli hoog transductie P P1 E. coli 1 (amplificeerbaar)transductie PAC P1 E. coli 1 elektroporatie BAC F E. coli 1 elektroporatie YAC ARS gist 1 transformatie P1, cosmiden: insertiegrootte beperkt door verpakkingsmogelijkheid in faagpartikels Belang :- kartering en analyse van complexe genomen ; isolatie operons - beter zicht op overlappende klonen (zie : DNA-banken) - opstellen van fysische kaarten - inzoemen op bepaalde genomische regio’s of operons (sequentieanalyse & hybridisatie) BAC, PACs: minder chimerisatie, eenvoudige bankconstructie, eenvoudige DNA-manipulaties – klonering/insertie YACs: chimerisatie/stabiliteit Overzicht : kloneren van grote fragmenten

3 E. coli bacteriofaag P1 getemperde faag van E. coli. medieert algemene transductie. het genoom is circulair gepermuteerd en terminaal redundant (10 kb). het unieke (niet-gerepeteerde) DNA is ongeveer 90 kb : faag DNA is dus ~ 110 kb bij lysogenie integreert het faag DNA niet in het chromosoom maar blijft als extrachromosomaal DNA in laag aantal kopijen in de cel ("als plasmide"). bij inductie tot lytische ontwikkeling fungeert een lytisch replicon tot hoog aantal kopijen. in het faaggenoom volgt ~ 5 kb na pac een loxP plaats : bij concatenatie volgen opeenvolgende loxP's elkaar op per ~ 90 kb. Pacase splitst per ~ 110 kb, zodat alleen het eerste product 2 loxP sequenties heeft. 2 loxP-sequenties : worden herkend door het product van het cre gen (Cre recombinase)  circularisatie van (alleen deze) DNA moleculen in E. coli (ook indien rec - ) in 1990 ontwikkeld tot een vectorsysteem waarin ~ 100 kb insereerbaar is totale capaciteit inpakbaar DNA : ~ 110 kb pac (‘packaging site’) sequentie : startplaats voor verpakking essentieel element, splitsing door Pacase kan ook in vitro gebruikt worden

4 “By contrast to bacteriophage, where vectors evolved from the work of many hundreds of investigators in traditional academic institutions, bacteriophage P1 vectors were the product of a single laboratory, that of N. Sternberg at the Dupont Merck Pharmaceutical Company, located in the then wilderness of Wilmington, Delaware (in : Molecular cloning, a laboratory manual, Sambrook & Russell)“ - Het “plasmide” replicon van P1 bestaat uit een ori en repA gen (+ controlegebied) essentieel RepA eiwit. Daarnaast ligt een par locus (2.7 kb). - Zoals bij  bepaalt de fysiologische toestand of de infectie richting lysogenie of lyse gaat. De concentratie van een P1 CI repressor bepaalt dit. Naast het R replicon (lysogenie) is er een L replicon (voor de lytische weg). L replicon : eerst  structuren ; schakelt dan over naar  replicatie. - Concatemeer DNA wordt gevormd : een prehead bindt dit DNA bij een pac plaats (162 bp) waar het P1-gecodeerde Pacase heeft gesplitst. Er wordt DNA ingepakt tot de pre-kop vol is ; daar volgt een sequentie-onafhankelijke splitsing en een nieuwe pre-kop wordt vanaf dit nieuwe uiteinde verder gevuld. - naast het Pacase, CI kodeert P1 ook voor het Cre recombinase, dat de loxP sequenties (34 bp) (13 bp inverted repeat) herkent en splitst. loxP : ATAACTTCGTATAGCATACATTATACGAAGTTAT

5 Het concatemeer DNA wordt gesplitst op opeenvolgende 110 kb posities (vanaf de pac). loxP plaatsen liggen ongeveer 90 kb uit elkaar (het unieke DNA in het P1 genoom is 100 kb). Er worden ongeveer 4 faagkoppen gevuld per concatemeer DNA, maar slechts één heeft twee loxP’s, en kan dus cycliseren in een recA E. coli mutant. (Cre is faaggekodeerd.)

6 Vector-DNA wordt bereid als twee armen, één met pac + loxP, de andere met de replicatiefuncties, resistentiemerker en loxP. In een trimoleculaire ligatiereactie wordt insert-DNA ingebouwd. Transductie naar een E. coli die het Cre-recombinase tot expressie brengt, zodat het verpakte DNA kan circulariseren Klonen met laag-kopijaantal – selectiemerker/kanamycine resistentie Eventueel hoger kopijenaantal via het P1 lytisch replicon Inserts tussen 70 en 100 kb Voorbeelden: P1 vector Ad10 (1990), pAD10sacBII In P1 vectoren is het lytisch replicon aangepast zodat het onder controle van de lac promotor staat en dus induceerbaar is met IPTG. Het inpakmechanisme gebeurt via een "headful" mechanisme, zodat voldoende "extra" DNA in de lange arm als "stuffer" aanwezig moet zijn. Oorspronkelijk werd daarvoor adenovirus DNA gebruikt, hetgeen de nomenclatuur van de eerste (en ook latere) vectoren verklaart. In latere vectoren werd vooral het sacB ingevoerd voor positieve selectie van recombinanten, evenals faag RNA-promotoren rond de insertieplaats om makkelijk RNA sondes te kunnen maken.

7 Faag P1 vectorsysteem nb. verpakking kan ook in vivo door infectie met wild-type P1 faag.

8 Faag P1 vector pAd10SacBII Kenmerken 2 loxP sequenties pac sequentie: verpakking in P1 faagpartikels kan r : kanamycineresistentiegen P1 plasmide-replicon: circulair DNA aan ~1 kopij/cel P1 lytisch replicon (‘lytisch replicon’) : onder controle van de lac promoter (induceerbaar met IPTG) : plasmide-amplificatie vóór DNA-isolatie (aantal kopijen stijgt van ~ 1 tot ~ 20 per cel) sacB: positieve selectiemerker voor klonen met insert-DNA (BamHI-site) met faag SP6 en T7 promotors rond de insertieplaats

9 Faag P1 vector pAd10SacBII

10 BAC vectoren : bacterieel artificieel chromosoom (1992) vectoren ontwikkeld op basis van het E. coli F plasmide : 1 of 2 kopijen per cel replicatie (unidirectioneel) vereist oriS en repE RepE : helicase (bevordert DNA replicatie) parA, parB en parC voor correcte partitie over de dochtercellen (stabiel behoud van het plasmide) antibioticumresistentiemerker nodig voor selectie insertie van DNA door in vitro ligatie (later, eventueel door recombinatie) er is geen selectie op insertgrootte transformatie door electroporatie ; geen verpakkingsextracten vereist (evenmin mogelijk) bij voorkeur gebruik van recA - E. coli waardcel structureel-stabiel behoud van mens- en plant-DNA (> 100 generaties) nieuwere BAC-vectoren : met lacZ  of sacB gen voor herkenning of positieve selectie van recombinanten unieke splitsbaarheid van grote DNA's vergemakkelijkt door het voorzien van cosN, loxP, SceI, NotI, SfiI,... T7 en SP6 promotoren voor aanmaak van RNA sondes zeer efficient voor genoomkartering en isolatie van operons, enz. Manipuleerbaarheid van het gekloond DNA is moeilijker gezien de grootte (unieke knipplaatsen?).

11 Voorbeeld : pBeloBACII

12 PAC vectoren : faag P1-afgeleid artificieel chromosoom 1994 Combinatie van elementen uit de BAC en faag P1 vectorsystemen replicatie zoals P1-vectoren, maar ontdaan van verpakkingssignalen sacB, positieve selectiemerker P1 plasmide en lytisch replicon geen verpakking in P1 faagpartikels geen cre-loxP systeem voor circularisatie – circularisatie bij in vitro ligatie introductie door elektroporatie Voorbeeld: pCYPAC1 insertgroottes bij klonering in BACs of PACs zijn vergelijkbaar ; eventuele geobserveerde verschillen hebben allicht eerder met DNA bereiding te maken dan met inherente karakteristieken. Inserties tot 300 kb bekomen ; DNA-banken hebben meestal een gemiddelde grootte tussen 80 en 120 kb.

13 Voorbeeld : pCYPAC1

14 YAC-vectoren : ‘yeast’ artificieel chromosoom 1987 zie : gistvectoren.

15 Bacteriophage is a double-stranded DNA virus that processes concatemeric DNA into virion chromosomes by cutting at specific recognition sites termed cos. A cos is composed of three subsites: cosN, the nicking site; cosB, required for packaging initiation; and cosQ, required for termination of chromosome packaging. During packaging termination, nicking of the bottom strand of cosN depends on cosQ, suggesting that cosQ is needed to deliver terminase to the bottom strand of cosN to carry out nicking. In the present work, saturation mutagenesis showed that a 7-bp segment comprises cosQ. A proposal that cosQ function requires an optimal sequence match between cosQ and cosNR, the right cosN half-site, was tested by constructing double cosQ mutants; the behavior of the double mutants was inconsistent with the proposal. Substitutions in the 17-bp region between cosQ and cosN resulted in no major defects in chromosome packaging. Insertional mutagenesis indicated that proper spacing between cosQ and cosN is required. Addendum :


Download ppt "Klonering van grote DNA segmenten : P1, BAC, PAC, YAC vectoren. cfr. o.a. Primrose & Twyman : hfdst. 5 Cosmiden : inserts 30-45 kbp : selectie door inpakrestrictie."

Verwante presentaties


Ads door Google