De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

GENETICA VAN GEHOORVERLIES. AANGEBOREN GEHOORVERLIES ~ 1 in 900 children has congenital hearing impairment >20 dB in one or more frequencies 50 % inherited.

Verwante presentaties


Presentatie over: "GENETICA VAN GEHOORVERLIES. AANGEBOREN GEHOORVERLIES ~ 1 in 900 children has congenital hearing impairment >20 dB in one or more frequencies 50 % inherited."— Transcript van de presentatie:

1 GENETICA VAN GEHOORVERLIES

2 AANGEBOREN GEHOORVERLIES ~ 1 in 900 children has congenital hearing impairment >20 dB in one or more frequencies 50 % inherited 50% environmental 70% Nonsyndromic30% Syndromic ~%77 AR ~%22 AD ~%1 X-linked <%1 Mitochondrial Usher Alport Pendred Norrie Waardenburg Branchio-Oto-Renal Jervell and Lange-Nielsen Ototoxic drugs Acustic trauma Infections ~%77 AR ~%22 AD Known Genes

3 WAAROM IS HET OPHELDEREN VAN OORZAKEN VAN ERFELIJKE ZIEKTEN BELANGRIJK?  Diagnose  Vraag van patiënt naar de oorzaak beantwoorden: is het erfelijk?  Adequaat erfelijkheidsadvies  Vroege diagnostiek van familieleden – goede begeleiding  Inzicht in genen/eiwitten die essentieel zijn voor ontwikkeling en functie van het binnenoor  Handvaten voor therapie

4 IN DE PRAKTIJK

5 AUDIOGRAMMEN

6 ARTA

7 Myosine VIIa Asn458Ile

8 HET BINNENOOR

9 INZICHT DOOR DOOFHEIDSGENEN Kazmierczak et al 2007

10 IDENTIFICATIE VAN ZIEKTEGENEN Familiestudies – goede klinische karakterisatie Identificatie van de chromosomale regio waarin het defect ligt - Koppelingsonderzoek – homozygotiemapping Identificatie van het defecte gen - Welke genen liggen er in de regio – genome browsers? - Welk van die genen is mogelijk betrokken? - databanken * Expressiepatroon * Functie van het gen * Diermodellen * Selectie van genen voor mutatieanalyse - Mutatieanalyse - Interpretatie van sequentievarianten Alternatief: Next Generation sequencing

11 TURKSE FAMILIES - CONSANGUINITEIT - Homozygote mutaties - Homozygotie mapping – linkage analyse

12  NM  NM  NM  NM  NM  MM x x mutation HOMOZYGOSITY MAPPING

13 … cctcctagggttgca a agcctccttggctatg… … cctcctagggttgca t agcctccttggctatg… Single Nucleotide Polymorphisms - SNPs Person B : Person A : … cctcctagggttgca t agcctccttggctatg… ~ 500,000 SNPs GTACCCTGATAAATTGGTACCCTGATAAATTG CTTGGCAGATAAATTACTTGGCAGATAAATTA

14 FAMILIE TR57  Linkage interval: 11q13.2–q13.4,  ~ 59 known genes, 18 hypothetical gene

15 DFNB63 LOCUS TECTA MYO7A USH1C DFNA32 DFNB20 DFNB24 DFNB51 DFNB63 D11S2371 D11S1337 D11S4179 D11S1291 D11S916 D11S1314 D11S4139 D11S4136 D11S4113 D11S987 ~5.29 Mb FGF3 DFNB63 Fam TR57 26 bekende of voorspelde genen Fam FT1A-G Fam PKDF702 Fam FT Mb

16 LRTOMT KARAKTERISATIE Genome browser build 36.1 LRTOMT1 LRTOMT2

17 EFFECT VAN MUTATIES E110K A29SfsX54 (c.358+4G>A) W105R R81Q A215A G163VfsX4 (c.358+4G>A) 3’ UTR Catechol-O-methyltransferase domein

18 MOLECULAR MODELING

19 EFFECT VAN MISSENSE MUTATIES

20 LRTOMT IN DE MUIS

21 BINNENOOR

22

23 SAMENVATTING  Toegepaste bioinformatica is essentieel voor verschillende stappen in studies naar ziektegenen  De structuur en functie van het humane genoom en genen zijn nog lang niet in kaart gebracht  De oorzaak van DFNB63 is gelegen in defecten in het LRTOMT gen. Het precieze effect van mutaties in dit gen op de functie van het binnenoor is nog niet duidelijk.


Download ppt "GENETICA VAN GEHOORVERLIES. AANGEBOREN GEHOORVERLIES ~ 1 in 900 children has congenital hearing impairment >20 dB in one or more frequencies 50 % inherited."

Verwante presentaties


Ads door Google