De presentatie wordt gedownload. Even geduld aub

De presentatie wordt gedownload. Even geduld aub

Bioinformatica: Leven in de computer. Inleidende les Binnenkort is er een computerpracticum van Nijmeegse student(en) over bioinformatica. Deze les is.

Verwante presentaties


Presentatie over: "Bioinformatica: Leven in de computer. Inleidende les Binnenkort is er een computerpracticum van Nijmeegse student(en) over bioinformatica. Deze les is."— Transcript van de presentatie:

1 Bioinformatica: Leven in de computer

2 Inleidende les Binnenkort is er een computerpracticum van Nijmeegse student(en) over bioinformatica. Deze les is noodzakelijk om voorbereid te worden in de bioinformatica. Inhoud van deze les: 1.Opfrissen moleculaire kennis 2.Een aantal voorbeelden van de bioinformatica in de praktijk. Benodigdheden: Pen of potlood Antwoordblad -inleidende les- BINAS of BioData

3 Inzoomen Van organisme naar molecuul In (bijna) iedere cel zit DNA DNA is het bouwplan voor een eiwit De vorm en functie van eiwitten zijn verantwoordelijk voor de functie van organellen en cellen De cellen bepalen hoe het weefsel werkt, hoe het orgaan functioneert en uiteindelijk hoe het hele organisme leeft.

4 Eiwitsynthese (3 min.)

5 Aminozuren en eiwitten TACGCCATACGACGGACCGACGACCCA AUGCGGUAUGCUGCCUGGCUGGGUUGA Hoe heten de processen die met pijlen staan aangegeven? Wat zijn de namen van deze aminozuren? Wat is de één-letter code van de gevonden aminozuren? UGA is een stopcodon, hoe werkt een stopcodon? Klik nogmaals voor de antwoorden Methionine (start), arginine, tyrosine, alanine, alanine, tryptofaan, leucine, glycine M RYAAWLG Er bestaat geen tRNA die past op UGA, de ketting aminozuren wordt hierdoor onderbroken. DNA RNA aminozuren ………. transcriptie translatie Pak je antwoordblad erbij!

6 Invloeden op niveau Een organisme wordt blootgesteld aan veel UV-straling Organisme Wat gebeurt er met een organisme bij veel UV-straling? Een organisme kan (huid)kanker krijgen. Cel Wat gebeurt er met een cel bij veel UV-straling? In pigmentcellen wordt pigment aangemaakt, bij andere cellen gebeurt weinig. DNA Wat gebeurt er met het DNA bij veel UV-straling? Er treden mutaties in het DNA op. EiwitWat gebeurt er met een eiwit bij veel UV-straling? Straling doet op zich niets met bestaande eiwitten, maar door het gemuteerde DNA worden nieuwe eiwitten verkeerd gevormd. Vul het schema op het antwoordenblad in. Er mogen vakken leeg blijven. Een voorbeeld voor de eerste kolom:

7 Invloeden op niveau Een levercel deelt OrganismeEen organisme heeft meer levercellen. Cel Een cel deelt (verdeelt organellen en legt DNA in juiste positie). DNAHet DNA verdubbelt zich. EiwitEr gebeurt niets met de eiwitten zelf. Antwoorden van de tweede kolom:

8 Invloeden op niveau Het DNA muteert in een niet-coderend gedeelte Organisme- Cel- DNA Het DNA heeft een andere volgorde van basen dan voorheen. Eiwit- Antwoorden van de derde kolom:

9 Invloeden op niveau Één eiwitmolecuul is verkeerd gevouwen OrganismeMet een organisme gebeurt niet zo veel. Cel Afhankelijk van de functie van het oorspronkelijke eiwit, verandert er iets aan de cel. Een verkeerde vouwing in een structuureiwit kan bijvoorbeeld een misvormde cel opleveren. DNA Er verandert niets aan het DNA, wel kan de oorzaak van de verkeerde vouwing in het DNA liggen. Door een mutatie bijvoorbeeld. EiwitDoor de verkeerde vouwing kan de functie van het eiwit verloren gaan. Antwoorden van de vierde kolom:

10 Wat is bioinformatica? Schrijf termen die te maken hebben met bioinformatica op het bord. Nu volgen twee voorbeelden van bioinformatica. Aan het einde van de les worden de opgeschreven termen nogmaals bekeken.

11 Voorbeeld 1: Het vogelbekdier

12 Snavel Gifklieren Zogen Legt eieren Een mengelmoes

13 Ook genetische mengelmoes ACGTGCATCGATCAACGCTACGCCCTAGCTGACTACGATTTCAGACTAGCTACGCTAGCTAGCTAGCTAGGCTTAGCTAAATCGCACATACTGCTACATATCGATACCATAGGATACAGATACAGATATAGAAATAGACACAGAGGGATAGACAGAGAGATATATAGAG DNA-volgorde met genen:De genen coderen voor verschillende eigenschappen van het vogelbekdier: Componenten van het vogelbekdiergif komen overeen met slangengif De voortplanting wordt bepaald door genen van reptielen én zoogdieren Bestanddelen van de melk zijn hetzelfde als mensen- moedermelk

14 Evolutionair gezien Stamboom vanaf Amniotes aangepast in 2008 Warren, W. et al. Genome analysis of the platypus reveals unique signatures of evolution Nature 453, (2008)

15 Voorbeeld 2: Ataxie van Friedriech Symptomen: Spierzwakte in armen en benen Coördinatieproblemen Beperkt gezichtsvermogen Gehoorverlies Onduidelijke spraak Symptomen: Spierzwakte in armen en benen Coördinatieproblemen Beperkt gezichtsvermogen Gehoorverlies Onduidelijke spraak Ongeneeslijk Erfelijk! frataxine Mutatie in het eiwit frataxine Spierziekte

16 Frataxine Frataxine is een eiwit dat betrokken is bij de verwijdering van ijzerionen (giftig!) rond de mitochondriën in het cytoplasma. Zonder frataxine worden de zenuw- en spiercellen aangetast. Gevolg: ruggenmerg wordt steeds dunner (degeneratie) Gevolg: slecht evenwicht, slappe armen en benen, vaak dingen laten vallen, slechte hand-oog-coördinatie

17 DNA-alignment Het gen dat codeert voor het eiwit frataxine bij Friedreich’s ataxie patiënten bevat heel veel repetities van de basen GAA: GAAGAAGAAGAAGAAGAAGAA Bij het gezonde gen frataxine, wordt GAA slechts 5-30 keer herhaald. Meer herhalingen leiden geleidelijk tot uitschakelen van het gen. GAA x 70 tot 1000 Met behulp van deze ontdekking (2006), worden specifieke medicijnen ontwikkeld! Klinische studies zijn nu gaande.

18 Andere toepassingen van bioinformatica Kennis van sterolen helpt bij het maken van cholesterolverlagende boter Met hulp van DNAvolgordes kunnen diagnostische tests worden uitgevoerd Enzymen die bij lage temperaturen actief zijn maken wasmiddelen beter Selectie op genen vergemakkelijkt plantenveredeling Bioinformatica

19 Afsluiting Kijk nogmaals naar de termen op het bord. Welke termen kunnen worden weggehaald? En kunnen nieuwe termen worden toegevoed? Tijdens het practicum kun je zelf aan de slag met bioinformatica!


Download ppt "Bioinformatica: Leven in de computer. Inleidende les Binnenkort is er een computerpracticum van Nijmeegse student(en) over bioinformatica. Deze les is."

Verwante presentaties


Ads door Google