Glycering en Complicaties

Presentatie over: "Glycering en Complicaties"— Transcript van de presentatie:

1 Glycering en Complicaties
Bruce H.R. Wolffenbuttel Afdeling Endocrinologie UMC Groningen

2 HbA1c is niet wat het lijkt …

3 UKPDS: hoger HbA1c = meer complicaties, goede diabetesregulatie = minder complicaties!
600 ogen, nieren 500 400 % 300 hart/vaten 200 100 0 HbA1c (%) 6,0 7,0 8,0 9,0 10,0

4 Ons lichaam heeft een 'olifantengeheugen' voor hyperglycemie
Langere follow-up (beide groepen Intensieve therapie bij type 1 nu intensieve behandeling) toont diabetes vertraagt complicaties verdere voordelen DCCT 1995 DCCT follow-up 2000

5 Snelle en langzame glycering
glucose HbA1c hemoglobine afbraak / eliminatie

6 Lage en hoge glycering - bij dezelfde bloedglucose veel hoger HbA1c
15 Laag 11 Normaal 10 Hoog 9 8 7 6 6 8 10 12 14 16 Gemiddelde bloedglucose (mmol/l) Hempe JM, et al. J Diab Compl 2002

7 Hoge glyceerders ontwikkelen veel sneller complicaties van ogen en nieren
hoge glycering van Hb komt tot uiting in andere weefsels, leidt tot meer eiwitglycering in weefsels en daardoor tot sneller optreden van ernstiger complicaties McCarter et al. Diabetes Care 2004

8 HbA1c is genetically determined
age Twin 1 Twin 2 Non-diabetic twins MZ concordant Men 12 36±10 10.6±2.2 10.6±2.3 Women 21 35±8 10.4±2.7 10.3±2.9 5.7±0.4 MZ discordant Men 22 40±12 10.2±2.0 6.7±1.0 Women 23 42±14 9.1±1.5 6.5±1.3 5.7±0.4

9 HbA1c is genetically determined
concordant twins discordant twins twin1 = diabetic twin1 = diabetic twin 2 = diabetic twin 2 = non-diabetic Snieder et al. Diabetes 2001;50:

10 Het krijgen van complicaties is sterk erfelijk bepaald …….

11 Consequences of AGE formation
1. Receptor uptake • cellular activation, amongst others possibly leading to atherosclerosis 2. Tissue accumulation on proteins • in the blood vessels - afterload • in the heart - diastolic dysfunction • in the kidney - matrix changes • in several collagenous tissues - LJM, CTS • on lipid particles: makes them more atherogenic 3. Renal excretion • related damage ??

12 'Stiff hand' syndroom en 'limited joint mobility'
Controle Diabetes

13 Expressie van CML-AGE in diabetische nefropathie
in mesangiale matrix, glomerulaire en tubulaire b.m., bloedvaten

14 Complicaties en erfelijkheid ?
• Slechts 30-50% ontwikkelt nephropathie, hoe slecht regulatie ook is • Familiale clustering van complicaties kan door andere factoren dan genen beinvloed worden, bijv. omgevingfactoren • Aanwezigheid (maar niet ernst) van nephropathie en ernst (maar niet aanwezigheid) van retinopathie bleek in families te clusteren (DCCT) • Hoogste correlaties in de moeder/kind paren: kan wijzen op intrauteriene milieu, dan wel op maternaal overerfde elementen (mitochondriaal DNA)

15 Complicaties genen + omgeving
Hyperglycemie Complicaties genen + omgeving AGE vorming hemodyn. lipiden PKC, Ang-II veranderingen bloeddruk VEGF, GH/IGF-1 Aldosereductase

16 The ACE I/D polymorphism

17 The ACE I/D polymorphism in diabetes
• Renal survival worse in type 2 diabetes with DD (Yoshida et al, Kidney Int 1996; 50: ) • Kidney function worse in type 1 diabetes with DD (Marre et al, JCI 1997; 99: ) • ACE-I larger therapeutic effect in type 1 diabetics with II polymorphism (Penno et al, Diabetes 1998; 21: 66-9; Jacobsen et al. Kidney Int 1998; 53: )

18 The ‘extreme phenotype’ approach
Patients were included when they had: 1. no / mild retinopathy and diabetes duration ≥ 20 years 2. proliferative retinopathy and laser photocoagulation within 15 years of diagnosis

19 Patient characteristics
No/mildDR PDR Age (yrs) 52 ± 12 43 ± 12 p=0.04 Diabetes duration (yrs) 32 ± 10 23 ± 6 p=0.03 Males/females 15 / 19 26 / 25 ns 3-year avg. HbA1c (%) 8.2 ± 1.0 8.3 ± 1.1 ns visual accuracy (VODS) 0.90 ± 0.15 0.82 ± ns Prevalence of (%): hypertension 10 15 ns macrovascular disease 20 15 ns

20 ACE I/D polymorphism in proliferative diabetic retinopathy
DD ID II Early PDR 12 16 6 < 15 yrs DM No/mild DR> 12 30 9 20 yrs DM p=0.43 DD vs I 12 / 22 vs 12 / 39 p=0.17

21 RAGE polymorphisms RAGE polymorphism primer sequence Ta [°C] Gly82Ser
for. 5’ GTAAGCGGGGCTCCTGTTGCA 3’ 63 rev. 5’ GGCCAAGGCTGGGGTTGAAGG 3’ promotor region, 388bp for. 5’ CCCTGGGTTTAGTTGAGAATTTTT 3’ 61 upstream start rev. 5’ CAGAGCCCCCGATCCTATTTA 3’ promotor region, 452 bp for. 5’ AAATATGGGTTGGGGTGCTT 3’ 61 upstream start rev. 5’ CTGCATCATGAAGGCAAGG 3’ RAGE Fragment Restriction Temperature Time [hours] enzyme [°C] Gly82Ser Alul 37 2 promotor region, 388 bp 2 upstream start Tsp509l 65 promotor region, 452 bp 1 upstream start Alul 37

22 RAGE polymorphism in diabetic retinopathy
PDR No PDR P Exon 3 A/G (Gly82Ser) 4 / 27 4 / 41 .34 Intron 7 G/T (1704G/T) 5 / 23 12 / 38 .30 Promotor TT 18 TT 25 . ? (388bp upstr T/A) AT 16 AT 18, AA 5 Del/T 3 Promotor CC 4 CC 4 . ? (452bp upstr T/C) CT 6 CT 14 TT 16 TT 23 T/del 3 In eerste aanleg geen opvallende genetische invloed van RAGE, maar: 1. kleine steekproef 2. personen met ‘deletie’ laag VEGF en sICAM

23 Complicaties bij diabetes
• Het ontstaan van complicaties is een interactie van erfelijke aanleg en omgeving • Specifieke complicaties hangen wsl. samen met specifieke erfelijke factoren • Het zoeken naar genetische factoren is nog maar net begonnen • Grote goed gedefinieerde patiëntengroepen zijn een voorwaarde voor adequaat genetisch onderzoek

24 AGEs meten ?

25 Pathways for AGE-formation and complications
Glucose Schiff’s base Amadori AP-ene 3-deoxy dion glucoson Protein AGEs RAGE Tissues clearance Complications

26 Pathways for AGE-formation and complications
Glucose Glucose Schiff’s base Triose-P auto-oxidation Amadori AP-ene 3-deoxy dion glucoson MG Protein AGEs RAGE Tissues clearance Complications

27 Pathways for AGE-formation and complications
Glucose Glucose Schiff’s base Triose-P G3P auto-oxidation Amadori AP-ene 3-deoxy dion glucoson MG Protein DAG AGEs in AGEs food / smoke Tissues clearance RAGE PKC Complications

28 Pathways for AGE-formation and complications
Glucose Glucose Schiff’s base Triose-P G3P auto-oxidation Amadori # # Oxygen # # free AP-ene 3-deoxy radicals dion glucoson # # MG # Protein DAG AGEs in AGEs food / smoke Tissues clearance RAGE PKC Complications

29 Verloop van HbA1c en AGEs tijdens insuline behandeling bij personen met type 2 diabetes
30 14 bloedglucose 12 25 * MGHI 10 * 20 8 HbA1c 6 15 * CML 4 10 2 ns 5 2 4 6 8 2 4 6 8 Tijd (maanden) Tijd (maanden) CML = Nε-carboxymethyllysine, HPLC MGHI = Methylglyoxal-derived hydroimidazolone, DELFIA, monoclonaal a.l. * = P < 0.05 Mentink et al, Neth J Med 2006

30 Meetopstelling AGE-meter
Kastje met de TL-lamp type ‘Black-light’ Computer Spectrometer Optische fiber

31 Alternatieve AGE-meting met licht
excitatie emissie = Autofluorescentie LOG 0,1 (nm) 600 0,01 300 350 400 450 500 550 Patient met veel Autofluorescentie dus veel AGEs 0,001 0,0001 0,00001 Patient met weinig Autofluorescentie, dus weinig AGEs Autofluorescence ratio (AFr): AFr = mean Int ( ) mean Int ( )

32 Survival in hemodialysis patients with skin autofluorescence above and below mean values
120 100 80 AF<mean 60 AF>mean 40 20 1 2 3 Years of follow-up Meerwaldt, 2004

33 Samenvatting • HbA1c is niet wat het lijkt …
• Het ontstaan van complicaties is een interactie van erfelijke aanleg en omgeving • Biochemische meting van AGEs (excl. HbA1c) is voorbehouden tot de research setting • Meting van AGEs met licht lijkt attractief om de kans op diabetische complicaties beter in te schatten

34 Sources of variance in HbA1c (as % of total HbA1c variance)
h2 HbA1c, genetic variance component (heritability) specifically influencing HbA1c; h2 glucose, genetic influence on HbA1c due to glucose; E2 HbA1c, unique environmental variance component specifically influencing HbA1c; E2 glucose, unique environmental influence on HbA1c due to glucose; age2, variance component due to age.